In vivo and in vitro evidence for the involvement of Nrf2-antioxidant response element signaling pathway in the inflammation and oxidative stress induced by particulate matter (PM10): the effective role of gallic acid

Environmental pollution is one of the risk factors for respiratory diseases. The nuclear factor erythroid 2-related factor 2 (Nrf2) is the major mechanisms contributing to cellular defense against oxidative damage. Gallic acid (GA) is regarded as potent anti-inflammatory and antioxidant agents. The aim was to evaluate the role of Nrf2 pathway in particulate matter (PM₁₀) exposure on lung and epithelial cells with an emphasis on the role of GA. In in vivo part, the rats were divided as control, GA (30?mg/kg), particulate matter (PM) (0.5, 2.5, and 5?mg/kg), and PM?+?GA. In in vitro study, the cells were divided as control, PM₁₀ (100, 250, and 500?µg/ml), GA (50 µmol/L) and PM₁₀+GA. Inflammation, oxidative stress and Nrf2-pathway factors were assessed. PM₁₀ groups showed a considerable increase in the epithelial permeability and inflammatory parameters. We also found a significant decrease in the expression of Nrf2 and its up-stream regulators genes. Accordingly, the biosynthesis of glutathione (GSH) and other antioxidant activities significantly decreased. Gallic acid was identified to restore the antioxidant status to the normal levels. Our findings approved that Nrf2 is involved in PM₁₀-induced oxidative damages and showed that Nrf2 activation by natural agents could ameliorate respiratory injuries induced by PM₁₀.     

3,5-disubstituted pyranone analogues of highly antifungally active furanones: conversion of biological effect from antifungal to cytostatic

A series of 3-aryl-5-acyloxymethyl-5,6-dihydro-2H-pyran-2-ones, related to highly antifungally active butenolides, was synthesized via cyclization of substituted δ-hydroxy acids as the key step, and evaluated for their in vitro antifungal activity and cytostatic activity. While the extension of the furanone ring to pyranone led to a complete loss of the antifungal effect, some of the compounds displayed promising effect against several cell lines, including the resistant colorectal carcinoma cells.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

The unsaturated acyclic nucleoside analogues bearing a sterically constrained (Z)-4′-benzamido-2′-butenyl moiety: Synthesis,X-ray crystal structure study,cytostatic and antiviral activity evaluations

A series of the novel acyclic unsaturated pyrimidine (1–12) and adenine (13) nucleoside analogues bearing conformationally restricted (Z)-2′-butenyl moiety were synthesized and evaluated for their antiviral and cytostatic activity potency against malignant tumor cell lines and normal human fibroblast (WI38). The N-1 and/or N-3 acyclic side chain substitution in pyrimidine ring in N-3 substituted 5-trifluoromethyluracil derivative (11), N-1, N-3 disubstituted 5-fluorouracil derivative (12) and adenine derivative (13) was deduced from their ¹H and ¹³C NMR spectra and confirmed by single crystal X-ray structure analysis. The X-ray crystal structure analysis 11–13 revealed also supramolecular self-assemblies, in which infinite chains or dimers built two- and three-dimensional networks. The results of the in vitro cytostatic activity evaluations of 1–13 indicate that the majority of the compounds tested exhibited a non-specific and moderate antiproliferative effect at the highest concentration (100 μM). Of all evaluated compounds on the cell lines tested only the N-1 4″-fluoro-substituted-benzamide uracil derivative (7) showed rather marked and selective inhibitory activity against the growth of MCF-7 cells at a concentration of 2.7 μM and no cytotoxic effect on normal fibroblasts WI38. This compound can be therefore considered as a potential antitumor lead compound for further synthetic structure modification.     

Importance of correct therapeutic procedure selection in voice recovery

Psychological and physical patient state as well as the influence of other social factor is of great influence voice rehabilitation. A team of experts in the field of voice and its function are involved in voice therapy. Our research was focused on the successfulness of voice recovery depending on the patient vocal disorder approach. We made a comparison of two methods: RVT and Accent method. We attempted to evaluate clinically relevant voice disorders in relation to certain vocal methods, we propose that a lot can be learned about voice trough therapeutic procedures, which can also be used to enhance the practical application of vocal methods and raise the level of success in dealing with people that suffer from voice pathology.     

Proteomic analysis of extracellular matrices used in stem cell culture

Numerous matrices for the growth of human embryonic stem cells (hESC) in vitro have been described. However, their exact composition is typically unknown. Information on the components of these matrices will aid in the development of a fully defined growth surface for hESCs. These matrices typically consist of mixture of proteins present in a wide range of abundance making their characterization challenging. In this study, we performed the proteomic analysis of five previously uncharacterized matrices: CellStart, Human Basement Membrane Extract (Human BME), StemXVivo, Bridge Human Extracellular Matrix (BridgeECM), and mouse embryonic fibroblast conditioned matrix (MEF-CMTX). Based on a proteomics protocol optimized using lysates from HeLa cells, we undertook the analysis of the five complex extracellular matrix (ECM) samples using a combination of strong anion and cation exchange chromatography and SDS-PAGE. For each of these matrices, we identify numerous proteins, indicating their complex nature. We also compared these results with a similar proteomics analysis of the growth matrix, Matrigel?. From these analyses, we observed that fibronectin is a primary component of nearly all hESC supportive matrices. This observation led to the investigation of the suitability of fibronectin as a defined ECM for the growth of hESCs. We found that fibronectin promotes the maintenance of pluripotent H9 and CA1 hESCs in an undifferentiated state using mTeSR1 medium. This finding validates the utility of characterizing matrices used for hESC growth in revealing ECM components required for culturing hESCs in a universally applicable defined system.     

Low VHL mRNA Expression is Associated with More Aggressive Tumor Features of Papillary Thyroid Carcinoma

Alterations of the von Hippel–Lindau (VHL) tumor suppressor gene can cause different hereditary tumors associated with VHL syndrome, but the potential role of the VHL gene in papillary thyroid carcinoma (PTC) has not been characterized. This study set out to investigate the relationship of VHL expression level with clinicopathological features of PTC in an ethnically and geographically homogenous group of 264 patients from Serbia, for the first time. Multivariate logistic regression analysis showed a strong correlation between low level of VHL expression and advanced clinical stage (OR = 5.78, 95% CI 3.17–10.53, P<0.0001), classical papillary morphology of the tumor (OR = 2.92, 95% CI 1.33–6.44, P = 0.008) and multifocality (OR = 1.96, 95% CI 1.06–3.62, P = 0.031). In disease-free survival analysis, low VHL expression had marginal significance (P = 0.0502 by the log-rank test) but did not appear to be an independent predictor of the risk for chance of faster recurrence in a proportion hazards model. No somatic mutations or evidence of VHL downregulation via promoter hypermethylation in PTC were found. The results indicate that the decrease of VHL expression associates with tumor progression but the mechanism of downregulation remains to be elucidated.     

Isothiocyanates: cholinesterase inhibiting,antioxidant, and anti-inflammatory activity

Finding a new type of cholinesterase inhibitor that would overcome the brain availability and pharmacokinetic parameters or hepatotoxic liability has been a focus of investigations dealing with the treatment of Alzheimer’s disease. Isothiocyanates have not been previously investigated as potential cholinesterase inhibitors. These compounds can be naturally produced from their glucosinolate precursors, secondary metabolites widely distributed in our daily Brassica vegetables. Among 11 tested compounds, phenyl isothiocyanate and its derivatives showed the most promising inhibitory activity. 2-Methoxyphenyl ITC showed best inhibition on acetylcholinesterase with IC₅₀ of 0.57?mM, while 3-methoxyphenyl ITC showed the best inhibition on butyrylcholinesterase having 49.2% at 1.14?mM. Assessment of the antioxidant efficacy using different methods led to a similar conclusion. The anti-inflammatory activity was also tested using human COX-2 enzyme, ranking phenyl isothiocyanate, and 3-methoxyphenyl isothiocyanate as most active, with ～99% inhibition at 50?μM.