Overexpression of proteins containing tyrosine- or leucine-based sorting signals affects transferrin receptor trafficking.

Targeting of many transmembrane proteins to post-Golgi compartments is dependent on cytoplasmically exposed sorting signals. The most widely used signals conform to the tyrosine- or the leucine-based motifs. Both types of signals have been implicated in protein localization to the same intracellular compartments, but previous results from both cell-free experiments and studies of transfected cell lines have indicated that the two types of signals interact with separate components of the sorting machinery. We have overexpressed several transmembrane proteins in stably transfected Madin-Darby canine kidney cells using an inducible promoter system. Overexpression of proteins containing tyrosine- or leucine-based sorting signals resulted in reduced internalization of the transferrin receptor, whereas recycling and polarized distribution was not influenced. Our results indicate that proteins with tyrosine- and leucine-based sorting signals can be transported along common saturable pathways.     

The Occurrence of Mycoplasmas and Bacteria in Lungs from Sheep in Southern Norway

In order to study the occurrence of mycoplasmas among Norwegian sheep, lungs from a great number of different herds were collected at 3 abattoirs in Southern Norway. The presence of fermenting mycoplasmas and bacteria was examined in both normal and pneumonic lungs to determine whether recovery of these agents could be related to pneumonic changes. Pneumonic lungs demonstrated lesions typical of the condition described as subacute or chronic pneumonia. Mycoplasma ovipneumoniae was found in 87 % of the 126 pneumonic lungs and in 6 % of the 83 normal lungs. Bacteria, mostly Pasteurella haemolytica, were less frequently encountered in the pneumonic lungs, and usually in combination with M. ovipneumoniae. It is concluded that M. ovipneumoniae is widespread among sheep in Southern Norway and can be considered to have etiological significance in subacute or chronic pneumonia, whereas bacteria probably occur mainly as secondary invaders. Changes resulting from moderate invasion by lungworm were found in about half of the lungs, but just as frequently in normal as in pneumonic lungs, and accordingly did not appear to contribute to the pneumonia investigated.     

Drivers of Vaginal Drug Delivery System Acceptability from Internet-Based Conjoint Analysis

Vaginal microbicides potentially empower women to protect themselves from HIV and other sexually transmitted infections (STIs), especially when culture, religion, or social status may prevent them from negotiating condom use. The open literature contains minimal information on factors that drive user acceptability of women’s health products or vaginal drug delivery systems. By understanding what women find to be most important with regard to sensory properties and product functionality, developers can iteratively formulate a more desirable product. Conjoint analysis is a technique widely used in market research to determine what combination of elements influence a consumer’s willingness to try or use a product. We applied conjoint analysis here to better understand what sexually-active woman want in a microbicide, toward our goal of formulating a product that is highly acceptable to women. Both sensory and non-sensory attributes were tested, including shape, color, wait time, partner awareness, messiness/leakage, duration of protection, and functionality. Heterosexually active women between 18 and 35 years of age in the United States (n = 302) completed an anonymous online conjoint survey using IdeaMap software. Attributes (product elements) were systematically presented in various combinations; women rated these combinations of a 9-point willingness-to-try scale. By coupling systematic combinations and regression modeling, we can estimate the unique appeal of each element. In this population, a multifunctional product (i.e., broad spectrum STI protection, coupled with conception) is far more desirable than a microbicide targeted solely for HIV protection; we also found partner awareness and leakage are potentially strong barriers to use.     

Termination of pregnancy in cases of fetal death in utero by intravenous prostaglandin F2alpha.

Delivery was induced by an intravenous infusion of prostaglandin F2alpha (PGF2alpha) in gradually increasing doses in 30 consecutive cases of fetal death in utero after the 28th week of gestation. Twenty patients delivered during the first day of prostaglandin administration, 9 on the second day, and 1 patient not until the third day of infusion. It is concluded, that intravenous PGF2alpha appears to be superior to oxytocin in termination of pregnancy under these conditions.     

The subsistence technology of capuchins

Via Oswalt’s system of classification, I compare the tool-kits of wild and captive capuchins with those of Tanzanian chimpanzees and Tasmanian aborigines. The results indicate that capuchins have tool-kits that are smaller, and have lower ratios of artifacts to naturefacts, than those of Tanzanian chimpanzees and Tasmanian aborigines. Accordingly, Oswalt’s system can be used productively to assess the relative technological skills of monkeys versus those of apes and humans.     

The susceptibility of Salvelinus fontinalis (Mitchill) to Gyrodactylus salaris Malmberg (Platyhelminthes; Monogenea) under experimental conditions

The host specificity of Gyrodaclylus Solaris is examined experimentally with respect to its ability to infect the brook trout, Salvelinus fontinalis . The parasite readily attached to and reproduced on parr of this host and infections grew for c. 20 days from first monitoring (c. 30 days from first infection) before declining. Parasites could persist on this host for up to 70 days before finally disappearing. The pattern of infection resembled that seen in many other gyrodactylid species on their normal hosts, and suggested the action of a host response, In this respect infections of G. salaris on parr of S. fontinalis , anadromous Salvelinus alpinus, Oncorhynchus mykiss, Thymallus thymallus and Baltic Salmo salar follow a normal pattern, while infections of Norwegian S. salar are unusual in a continued unchecked growth, until the host dies, under pooled laboratory conditions.     

Use of the granulosa cell aromatase bioassay for measurement of bioactive follicle-stimulating hormone in urine and serum samples of diverse species

Ovarian steroids and growth factors are intragonadal modulators which augment a key endpoint of follicle-stimulating hormone (FSH) action in granulosa cells: the induction of aromatase activity. Studies of these paracrine hormones that enhance FSH-stimulated estrogen biosynthesis by cultured rat granulosa cells, have led to the development of a sensitive and specific bioassay for FSH. This newly developed granulosa cell aromatase bioassay (GAB) allows for the measurement of bioactive FSH levels in serum and urine of humans and animals with various physiological and pathological conditions. These studies have demonstrated that the GAB assay is useful in detecting possible changes in the molecular forms of FSH. The adaptation of this method for urine samples allows for the measurement of bio-FSH levels in situations where venipuncture is not practical or in species for which specific radioimmunoassays are not available.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.