A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Characterization of the inhibitory effect of glucocorticoids on the DNA replication of adult rat hepatocytes growing at various cell densities

Dexamethasone inhibited the basal and EGF-stimulated DNA synthesis of adult rat hepatocytes in primary culture. The inhibition was glucocorticoid-specific: It was shown by dexamethasone and hydrocortisone, but not by progesterone, testosterone, or estradiol; and was counteracted by the glucocorticoid antagonist RU-38486 in a concentration-dependent manner. Dexamethasone acted by decreasing the rate of entry into S-phase (kG1/S), while cell cycle parameters were unaffected. The steroid was able to decrease the kG1/S severalfold even when added more than 20 hr after EGF, half-maximal effect occurring 11 hr after the addition of dexamethasone. Densely populated areas were much more sensitive to the inhibition by dexamethasone than sparsely populated areas within the same culture dish: A moderate (10 nM) concentration of dexamethasone nearly abolished the DNA synthesis in densely populated areas of hepatocyte cultures with only marginal effect on sparsely populated cells.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Coexpression of cytokeratin and vimentin in Rathke's cysts of the human pituitary gland

Summary Immunohistochemistry with monoclonal and polyclonal antibodies revealed the presence of cytokeratins in epithelial cells of Rathke's cysts in the pars intermedia of the human pituitary gland. With monoclonal antibodies specific for individual cytokeratins, the expression of CK 18, CK 8, CK 7, and CK 19 could be shown in these cells. Within the hypophysis, CK 19 and CK 7 were restricted to Rathke's cysts and a few epithelial cell clusters in the pars tuberalis, whereas other cytokeratins were also present in endocrine cells of the pars distalis. Furthermore, vimentin and, focally, glial fibrillary acidic protein (GFAP) were detected in the cystic epithelia. By double labelling, coexpression of cytokeratin and vimentin, GFAP and cytokeratin, and GFAP and vimentin could be demonstrated. Compiled data of all known cases of coexpression of cytokeratin and vimentin in normal cells reveal physiological correlations and suggest a functional significance of this rare type of coexpression of intermediate filament proteins.