Microorganisms surviving for 5300 years

Abstract Recently, the well-preserved corpse of a prehistoric man with an age of approximately 5300 years bp was discovered in the Central European Alps. Analysis of materials associated with the individual has revealed the presence of microorganisms which are believed to have survived since the time of death. So far, two fungi have been isolated and identified as species of the genera Chaetomium and Absidia , respectively. In addition, we have obtained one bacterial isolate which we have identified as a Streptomyces species. Our findings demonstrate that microorganisms can remain viable under appropriate circumstances for thousands of years. The isolates may enable us to study evolutionary trends within microorganisms.     

Regulation by insulin of glucose metabolism in mammary gland of anaesthetized lactating rats. Stimulation of phosphofructokinase-1 by fructose 2,6-bisphosphate and activation of acetyl-CoA carboxylase.

The effect of insulin on glucose metabolism in mammary gland was studied by the euglycaemic/hyperinsulinaemic-clamp technique. Measurement of metabolite concentrations and enzyme activities in the mammary gland suggests two sites of action of insulin: phosphofructokinase-1 and acetyl-coA carboxylase. The increase in phosphofructokinase-1 activity could be linked to the 2-fold increase in fructose 2,6-bisphosphate concentration, since no change in maximal activity and in sensitivity of the enzyme toward fructose 6-phosphate was detected in vitro.     

Morphological and biomechanical studies of the ligamentum arteriosum

Fifteen ligaments taken from individuals aged between 60 and 80 years were used for the study of the histological structure, the composition of the ground substance and the biomechanical behavior. Remnants of the original duct are recognizable in the ligament as artery of the muscular type. What had been the intima is thickened and consists mainly of cell-poor, fiber-rich connective tissue, which often shows chondrification along with calcification. The biomechanical behavior of the ligaments, evaluated with the force-length and force-relaxation test, was similar to that of peripheral arteries.     

Characterization of mononuclear phagocytes in schistosomal egg granulomas of athymic mice

Macrophages from schistosomal egg granulomas of athymic mice (nu/nu GM) and their euthymic littermates (nu/+ GM) were analyzed phenotypically for the expression of antigens encoded by the I-A subregion of the major histocompatibility complex and for their ability to perform as antigen-presenting cells. Only 11 to 15% of nu/nu GM expressed I-A antigens as compared to 61.5 to 75% of nu/+ GM. Although both populations of cells appeared to be equally effective as antigen-presenting cells appropriately sensitized lymphocytes in the presence of specific antigens--soluble schistosomal egg antigen (SEA) and human gamma-globulin (HGG)--only nu/nu GM, but not nu/+ GM, were found to stimulate I-A-restricted proliferation of schistosome-sensitized T cell populations in the absence of SEA added in vitro. Furthermore, nu/nu GM but not nu/+ GM were shown to exhibit significant proliferative capacity in vitro, but this phenomenon could not account for the observed difference in SEA-independent T cell stimulation. Finally, culture supernatants from nu/nu GM displayed significant thymocyte-stimulating activity, consistent with interleukin 1, which was not observed in nu/+ GM. These findings point to significant differences between nu/nu GM and nu/+ GM, which may be part of an adaptive mechanism of granulomatous reactivity in the absence of a competent T cell system.     

Proteinase Inhibitor II Gene Expression Induced by Electrical Stimulation and Control of Photosynthetic Activity in Tomato Plants

Mechanical damage and heat stimulation were used to activateproteinase inhibitor II (Pin2) gene expression in tomato plantsin both treated (local induction) and non-treated tissues (systemicinduction). Both stimuli have been shown to generate electricalsignals, leading to a systemic activation of gene expression.Treatment of tomato leaves with electrical current resultedin the accumulation of Pin2 mRNA in the local and systemic leaves.Additionally, all treatments inducing Pin2 gene activity gaverise to a significant alteration of stomatal aperture. However,heat stimulation provoked a different response in the stomatalparameters than mechanical wounding or electric treatment. Bothmechanical damage and electrical stimulation activated two characteristictime constants in the gas exchange relaxation kinetics. Conversely,heat stimulation resulted in only one major time constant. Theresults clearly show that direct current application to tomatoleaves initiates Pin2 mRNA accumulation locally and systemically.In addition, they suggest the participation of a second slowelectrical/hydraulic component in the wound response mechanismof tomato plants and a possible alternative pathway regulatingheat-induced Pin2 gene expression. (Received February 13, 1995; Accepted April 14, 1995)     

Selenoprotein P associates with endothelial cells in rat tissues

 Selenoprotein P is an extracellular heparin-binding protein that has been implicated in protecting the liver against oxidant injury. Its location in liver, kidney, and brain was determined by conventional immunohistochemistry and confocal microscopy using a polyclonal antiserum. Selenoprotein P is associated with endothelial cells in the liver and is more abundant in central regions than in portal regions. It is also present in kidney glomeruli associated with capillary endothelial cells. Staining of selenoprotein P in the brain is also confined to vascular endothelial cells. The heparin-binding properties of selenoprotein P could be the basis for its binding to tissue. Its localization to the vicinity of endothelial cells is potentially relevant to its oxidant defense function. Accepted: 6 March 1997     

Increases in α-mannosidase activity in the arbuscular mycorrhizal symbiosis of Allium schoenoprasum

 Mycorrhizal and nonmycorrhizal roots of Allium schoenoprasum were tested for activities of α-mannosidase, β-glucosidase and arabinosidase. Mannosidase activity was higher by a factor of two in mycorrhizal than in nonmycorrhizal root extracts. The apparent molecular weight of the enzyme was 152 kDa and its K_M was 1.25 mM in colonized roots and 1.85 mM in uncolonized roots. α-Mannosidase activity was further characterized by an acid pH optimum and Zn²⁺ dependency. No significant differences could be found between mycorrhizal and nonmycorrhizal roots for β-glucosidase and arabinosidase activities. Accepted: 28 August 1995     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.