Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effects of nucleotides and divalent cations on phospholipase activity in Saccharomyces cerevisiae

Divalent cations activate the lysophospholipase and transacylase reactions catalyzed by the same enzymes in the yeast Saccharomyces cerevisiae. The activation was observed at neutral pH, but not at the pH optimum of lysophospholipase/transacylase, near 3.5. Adenine nucleotides, especially AMP and ADP, are strong inhibitors of the same group of enzymes. Half maximal inhibition by AMP was found at a concentration of about 20 M. The inhibition by nucleotides in low concentrations is enhanced by divalent cations.     

The quaternary structure of four crustacean two-hexameric hemocyanins: immunocorrelation,stoichiometry, reassembly and topology of individual subunits

Summary Two-hexameric (2×6) hemocyanins from the brachyuran crabsCancer pagurus andCallinectes sapidus, the freshwater crayfishAstacus leptodactylus and the lobsterHomarus americanus were isolated and dissociated into native subunits.The subunits of each hemocyanin were analyzed by electrophoresis and immunology. Three immunologically distinct subunit types, which were termed, and, could be identified in each case. They were isolated preparatively, and interspecifically correlated. Subunit is subdivided into several electrophoretically distinct isoforms which are immunologically closely related (Astacus) or identical (other species). InAstacus andCancer one of these isoforms was shown to dimerize and to act as inter-hexamer bridge. It represents a fourth subunit type termed. A fifth, diffuse component, which in PAGE migrated at the position of a dimer, was identified in the crossed immunoelectrophoretic patterns as denatured hemocyanin.A common feature of the four hemocyanins is the presence of 4 copies of and 8 copies of/ within the 2×6 particles. The: ratio is 4:4 in the two Astacidea and 6:2 in the two Brachyura. exists in 2 copies inAstacus andCancer which means that a single dimer- is present in a two-hexamer. This leaves 2 monomeric copies inAstacus and 4 inCancer.Every subunit from the four species except ofAstacus - was capable to form hexamers in reassembly experiments. If subunit combinations were tested, hetero-hexamers were formed preferentially. Two-hexamers were reconstituted only in the presence of all subunit types and the native subunit stoichiometry was required to obtain twohexamers in considerable yields. Factors limiting 2×6 reassembly are discussed.Authentic 2×6 molecules ofAstacus, Homarus andCancer hemocyanin were immunolabeled with subunit-specific antibody fragments (F_ab) or IgG molecules, and the resulting immuno complexes were studied in the electron microscope. A topological model of the quaternary structure of decapod 2×6 hemocyanins is derived, showing the position of each copy of the four subunit types. In this model, the inter-hexamer bridge- is surrounded by two and two subunits forming the central core of the dodecamer. Two additional and two additional subunits form the periphery together with one subunit occupying the peripheral short edges of each hexameric half structure. The model is discussed with respect to the current literature.Abbreviations PAGE polyacrylamide gel electrophoresis - SDS sodium dodecyl sulfate This paper is decicated to Professor Dr. Bernt LinzenPreliminary accounts of this work have been presented in the proceedings of a symposium at Tutzing 1985. Linzen B (ed) (1986) Invertebrate oxygen carriers. Springer, Berlin Heidelberg New York. This also includes: Stöcker et al. 1986; Markl et al. 1986) and in a review article (Markl 1986)     

Extinction of populations by random influences

A unifying approach described by a random birth and death process which includes both environmental and demographic noise is introduced. It is shown that both of these noise sources play an essential role in extinction processes in general. The probability distribution of the lifetime of a population is determined and its dependence on the parameters of the model is discussed. Finally a population divided into subpopulations is modeled. The lifetime of this ensemble of subpopulations is compared to the lifetime of one large population.     

Semisynthetic des-(B27-B30)-insulins with modified B26-tyrosine

Semisynthetic des-(B27-B30)-insulins containing modified B26-tyrosine residues were prepared to refine the understanding of the importance of position B26 with regard to biological and structural properties of the hormone. The following shortened insulin analogues were synthesized by trypsin-catalysed peptide-bond formation between the C-terminal amino acid ArgB22 of des-(B23-B30)-insulin and synthetic tetrapeptides as amino components: des-(B27-B30)-insulin, des-(B27-B30)-insulin-B26-methyl ester, -B26-carboxamide with varying C-terminal hydrophobicity of the B-chain, and [Tyr(NH2)B26]-, [Tyr(NO2)B26]-, [Tyr(I2)B26]-, [D-TyrB26]des-(B27-B30)-insulin-B26-carboxamide containing non-proteinogenic amino acids in position B26. Starting from insulin and an excess of synthetic Gly-Phe-Phe-Tyr-OMe as nucleophile, des-(B27-B30)-insulin-B26-methyl ester--the formal transpeptidation product at ArgB22--was formed in one step. Biological in vitro properties (binding to cultured human IM-9 lymphocytes, relative lipogenic potency in isolated rat adipocytes) of all semisynthetic analogues are reported, ranging from slightly decreased to two-fold receptor affinity and nearly three-fold biopotency relative to insulin. If the C-terminal tetrapeptide B27-B30 is removed, full relative insulin activity is still preserved, while the shortening results in the loss of ability to associate in solution. Only after carboxamidation or methyl esterification of TyrB26 the self-association typical of native insulin can be observed, and the CD-spectral effects in the near UV spectrum related to association and hexamerization of the native hormone are qualitatively reestablished. The results of this investigation underline the importance of position B26 to the modulation of hormonal properties and solution structure of the shortened insulins.     

A specific point mutation in the mitochondrial genome of Caucasians with MELAS

Summary The mitochondrial DNA (mtDNA) of Japanese patients suffering from the syndrome of mitochondrial myopathy, encephalopathy, lactic acidosis and strokelike episodes (MELAS) exhibits a specific heteroplasmic AG transition in the tRNA^Leu at position 3243. In this study, we investigated mtDNA from skeletal muscle, cardiac muscle, brain, liver, diaphragm, fibroblasts and blood cells of four Caucasians with MELAS, one younger healthy sister of two MELAS patients, and eleven controls. We found that 1) the mutation was present in all investigated tissues of Caucasians with MELAS but not in controls, 2) within a single patient, the tissue-specific variation of the copy number of mutated mtDNA covered the same range as in the skeletal muscle of different patients, 3) the mutation was also present in the blood cells of the healthy sister of two MELAS siblings.     

Expression of the chemically synthesized gene for ribonuclease T1 in Escherichia coli using a secretion cloning vector

The gene for ribonuclease T1 from Aspergillus oryzae has been chemically synthesized using the segmental support technique. An Escherichia coli clone producing the ribonuclease at high levels was constructed by linking the gene downstream to the region coding for the signal peptide of the OmpA protein (a major outer membrane protein of E. coli), using the secretion cloning vector pIN-III-ompA2. This strategy was employed in order to circumvent a possible toxic effect of the gene product on the host cell. Active ribonuclease containing four additional amino acids at the N-terminus could be isolated from the periplasmic fraction of the host. The final yield after purification was 20 mg enzyme/l liquid culture. With respect to immunological, catalytic and specific behaviour, no qualitative differences could be detected between the enzyme from the over-producing E. coli strain and ribonuclease T1 isolated from A. oryzae.     

Effects of dehydration on the vasopressin response to immersion

Nine healthy volunteers underwent three experimental procedures in random order. The protocols were 4 h of thermal dehydration followed by 2 h of head-out water immersion, 4 h of thermal dehydration followed by 2 h of chair rest, and 6 h of rest in the supine position. Four hours of heat exposure (50 degrees C) resulted in a body weight loss of approximately 3.5%. Plasma osmolality rose by approximately 5 mosmol/kg, mean arterial pressure (MAP) decreased from 85 to 78 mmHg, and body temperature increased from 36.8 to 38.6 degrees C. As a consequence of the combined action of hypertonicity, hypovolemia, hypotension, and hyperthermia, plasma arginine vasopressin (AVP) increased from 2.1 to 8.1 pg/ml after 4 h thermal dehydration. Changes in body weight, plasma osmolality, body temperature, and MAP were similar after either a subsequent 2 h of water immersion or 2 h of chair rest. However, during chair rest plasma AVP remained elevated (8.4 pg/ml), whereas during immersion plasma AVP decreased from 8.1 to 4.7 pg/ml. This was probably due to the central hypervolemia induced by immersion. Our results support the hypothesis that central hypervolemia rather than hypotonicity is the primary stimulus for AVP suppression during water immersion in dehydrated subjects. During the early immersion period hypoosmolality might contribute to the AVP suppression.     

Temperature-sensitive mutants of MH2 avian leukemia virus that map in the v-mil and the v-myc oncogene respectively.

MH2 is an avian retrovirus that contains the v-mil and v-myc oncogenes. In vitro it transforms chick macrophages that are capable of proliferation in the absence of growth factor. Earlier work showed that v-myc induces macrophage transformation and that v-mil induces the production of chicken myelomonocytic growth factor (cMGF), thus generating an autocrine system. We describe the isolation of temperature-sensitive (ts) mutants of MH2 virus. As suggested by marker rescue experiments, one mutant bears a ts lesion in v-mil, whereas the other carries a mutation in v-myc. Ts v-mil MH2-transformed macrophages become factor-dependent at the non-permissive temperature (42 degrees C), while ts-v-myc MH2-transformed macrophages cease growing and acquire a more normal macrophage phenotype at 42 degrees C irrespective of the presence of cMGF. Both phenotypes can be reversed by backshift to the permissive temperature. These results suggest that the gene products of v-mil and v-myc function independently of each other and that v-mil is necessary for the maintenance of autocrine growth, whereas v-myc is required to maintain the transformed phenotype.