Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

Effects of Heart Rate Variability Biofeedback on EEG Alpha Asymmetry and Anxiety Symptoms in Male Athletes: A Pilot Study

Heart rate variability biofeedback (HRV-BFB) has been shown as useful tool to manage stress in various populations. The present study was designed to investigate whether the biofeedback-based stress management tool consisting of rhythmic breathing, actively self-generated positive emotions and a portable biofeedback device induce changes in athletes’ HRV, EEG patterns, and self-reported anxiety and self-esteem. The study involved 41 healthy male athletes, aged 16–21 (mean 18.34 ± 1.36) years. Participants were randomly divided into two groups: biofeedback and control. Athletes in the biofeedback group received HRV biofeedback training, athletes in the control group didn’t receive any intervention. During the randomized controlled trial (days 0–21), the mean anxiety score declined significantly for the intervention group (change-4 p < 0.001) but not for the control group (p = 0.817). In addition, as compared to the control, athletes in biofeedback group showed substantial and statistically significant improvement in heart rate variability indices and changes in power spectra of both theta and alpha brain waves, and alpha asymmetry. These changes suggest better self-control in the central nervous system and better flexibility of the autonomic nervous system in the group that received biofeedback training. A HRV biofeedback-based stress management tool may be beneficial for stress reduction for young male athletes.     

Purine and pyrimidine bases and nucleosides of germinating Triticum aestivum seeds

Adenine, guanine, uracil and the corresponding nucleosides were identified in mature wheat grain. On germination, contents of these compounds changed in a regular pattern. Amounts of the free bases rose immediately and remained at the increased levels for a short period (3–6 hr). Nucleoside content decreased at the initial phase and increased sharply 12 to 48 hr after germination.     

Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.

The gene responsible for cystic fibrosis, the most common severe autosomal recessive disorder, is located on the long arm of human chromosome 7, region q31-q32. The gene has recently been identified and shown to be approximately 250 kb in size. To understand the structure and to provide the basis for a systematic analysis of the disease-causing mutations in the gene, genomic DNA clones spanning different regions of the previously reported cDNA were isolated and used to determine the coding regions and sequences of intron/exon boundaries. A total of 22,708 bp of sequence, accounting for approximately 10% of the entire gene, was obtained. Alignment of the genomic DNA sequence with the cDNA sequence showed perfect colinearity between the two and a total of 27 exons, each flanked by consensus splice signals. A number of repetitive elements, including the Alu and Kpn families and simple repeats, such as (GT)17, (GATT)7, and (TA)14, were detected in close vicinity of some of the intron/exon boundaries. At least three of the simple repeats were found to be polymorphic in the population. Although an internal amino acid sequence homology could be detected between the two halves of the predicted polypeptide, especially in the regions of the two putative nucleotide-binding folds (NBF1 and NBF2), the lack of alignment of the nucleotide sequence as well as the different positions of the exon/intron boundaries does not seem to support the hypothesis of a recent gene duplication event. To facilitate detection of mutations by direct sequence analysis of genomic DNA, 28 sets of oligonucleotide primers were designed and tested for their ability to amplify individual exons and the immediately flanking sequences in the introns.     

Polypeptide structure of germin as deduced from cDNA sequencing

Synthesis of a relatively rare glycoprotein (germin) signals the onset of growth in germinating wheat embryos. Germin mRNA (1075 nucleotide residues) has an 85-residue 5'-untranslated sequence, a 69-residue sequence that can encode a 23-residue signal-peptide sequence, a 603-residue sequence that can encode a 201-residue mature-protein sequence, and a 318-residue 3'-untranslated sequence that begins with a UAA-terminator codon, ends with a 63-residue polyadenylate tract, and has three polyadenylation (and other, related) signals (AAUAAN etc.). One polyadenylation signal is just 9 nucleotides from the polyadenylation site, the shortest stretch of nucleotides yet found between polyadenylation signal and site in any animal or plant mRNA. The mature-protein coding sequence in germin mRNA contains an unusually high proportion (87%) of G + C in the third positions of its codons. The amino acid sequence of germin does not have extensive internal homologies or repetitions, and it is not characterized by regions of unusually high charge density, as is nucleoplasmin, another water-soluble homopentameric protein with otherwise closely related structural properties. Germin does, however, contain a stretch of 34 uncharged amino acid residues and these may possibly mediate its homopentameric structure and its remarkable resistance to enzymic proteolysis. In view of a possible association of germin with cellular membranes, the most interesting relatedness of the germin sequence to the sequences of other proteins is an 80% homology between a decapeptide sequence in mature germin and a decapeptide sequence in Escherichia coli glycerol-3-phosphate acyltransferase. The relation of germin-gene structure to overall gene regulation during early plant growth is discussed.     

Increasing the efficiency of the enzymatic hydrolysis of potato starch in a membrane reactor

The aim of the work was to define the physicochemical parameters of a reaction system that alter the effectiveness of a continuous recycle membrane reactor during potato starch hydrolysis. The enzymatic hydrolysis of starch in an ultrafiltration reaction system proceeded with a continuous decrease in the permeate flux, accompanied by an increase in dry substance content in both the permeate and retentate fractions. The decrease in the permeate flux was caused by an increase in feed viscosity. If a prehydrolysis process was conducted, it was possible to enzymatically hydrolyse potato starch in solutions with concentrations up to 20%. A quasi-steady state of starch enzymatic hydrolysis was reached in the ultrafiltration reaction system by alternately supplementing it with starch solution and water.