Termination of pregnancy in cases of fetal death in utero by intravenous prostaglandin F2alpha.

Delivery was induced by an intravenous infusion of prostaglandin F2alpha (PGF2alpha) in gradually increasing doses in 30 consecutive cases of fetal death in utero after the 28th week of gestation. Twenty patients delivered during the first day of prostaglandin administration, 9 on the second day, and 1 patient not until the third day of infusion. It is concluded, that intravenous PGF2alpha appears to be superior to oxytocin in termination of pregnancy under these conditions.     

The subsistence technology of capuchins

Via Oswalt’s system of classification, I compare the tool-kits of wild and captive capuchins with those of Tanzanian chimpanzees and Tasmanian aborigines. The results indicate that capuchins have tool-kits that are smaller, and have lower ratios of artifacts to naturefacts, than those of Tanzanian chimpanzees and Tasmanian aborigines. Accordingly, Oswalt’s system can be used productively to assess the relative technological skills of monkeys versus those of apes and humans.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Distamycin inhibition of topoisomerase I-DNA interaction: a mechanistic analysis.

Inhibition of eukaryotic DNA topoisomerase I by the minor groove binding ligand, distamycin A, was investigated. Low concentrations of the ligand selectively prevented catalytic action at a high affinity topoisomerase I binding sequence. A restriction enzyme protection assay indicated that the catalytic cycle was blocked at the binding step. Distamycin binding sites on DNA were localized by hydroxyl radical footprinting. A strongly preferred site mapped to a homopolymeric (dA).(dT)-tract partially included in the essential topoisomerase I binding region. Mutational elimination of the stable helix curvature associated with this ligand binding site demonstrated that (i) the intrinsic bend was unessential for efficient binding of topoisomerase I, and (ii) distamycin inhibition did not occur by deformation of a stable band. Alternative modes of inhibition are discussed.     

Drug Stimulated DNA Cleavage Mediated by Cauliflower Topoisomerase II

We have investigated cauliflower (Brassica oleracea) topoisomerase II with respect to its interaction with DNA and demonstrate that the enzyme shares the characteristics of topoisomerase II purified from a variety of phylogenetically remote organisms. In the presence of the 2-nitroimidazole Ro 15-0216, cauliflower topoisomerase II-mediated DNA cleavage is extensively stimulated (approximately 20-fold) only at a site recognized as a major cleavage site for the enzyme in the absence of drug. The conservation of the enzyme's DNA specificity in the presence of Ro 15-0216 is in contrast to the effect exerted by traditional topoisomerase II inhibitors, which cause enzyme-mediated cleavage to take place at a multiple number of DNA sites. Ro 15-0216 may therefore prove useful as a tool in the elucidation of the enzyme's DNA interaction sites and its involvement in nucleic acid metabolism in plant cells.     

Characterization of microcarrier cultures of neurons and astrocytes from cerebral cortex and cerebellum

In the present investigation a method is described for culturing cerebellar granule cells (glutamatergic neurons), cerebral cortical neurons (GABAergic neurons) and cortical astrocytes on Cytodex 3 microcarriers. It was possible to obtain a high yield of attached neurons and astrocytes on the microcarriers and the cell specific characteristics such as the ability to release neurotransmitter (neurons) and a high activity of glutamine synthetase (astrocytes) were preserved. This system, allowing mixtures of neurons and astrocytes at any given ratio to be produced, may constitute an attractive model system by which the interaction between neurons and astrocytes with regard to exchange of neurotransmitter precursors as well as other compounds may be studied.     

A high affinity topoisomerase I binding sequence is clustered at DNAase I hypersensitive sites in Tetrahymena R-chromatin

Topoisomerase I is associated with DNAase I hypersensitive sites in the nontranscribed spacers flanking the rRNA genes in Tetrahymena thermophila. The endogenous topoisomerase I introduces site and strand specific single-strand cleavages in the rDNA spacers in situ. The cleavages occur base specifically within a hexadecameric sequence element present in two or three direct repeats at the hypersensitive sites. The sequence specificity and polarity of the cleavage reaction are identical when the enzyme is reacted with naked rDNA, indicating that the repetitive element functions as a high-affinity topoisomerase I attraction site in the r-chromatin. The biological mechanism associated with this phenomenon appears to be widespread among eukaryotes, since the topoisomerase I recognition sequence is conserved in the rDNA spacers of phylogenetically remote organisms, such as fungi, slime molds, ciliates, and insects.     

Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme.