Isolation and characterization of the two major apoproteins in human lipoprotein [a]

Human Lp[a] was isolated in preparative amounts from two donors; the native lipoprotein and its constituent apoproteins, apo[a] and apoB, were characterized extensively. Based on differences in apparent molecular weight, four different isoforms of apo[a], a1-a4, were observed between the two donors. The number and relative distribution of these isoforms varied between donors but were constant for each donor. Each apo[a] isoform was shown to be derived from a discrete apo[a]-B100 disulfide-linked complex present before reduction. Complete delipidation of Lp[a] was followed by solubilization, reduction, and carboxamidomethylation of the constituent apoproteins. These apoproteins were then separated by immunoaffinity chromatography using anti-apo[a]- or anti-apoB-Sepharose; their purity and structural integrity were demonstrated by Western blot analysis. ApoB isolated by this procedure was essentially identical to apoB from autologous LDL with respect to molecular weight, secondary structure, amino acid composition, and sialic acid content. However, apo[a] differed from apoB in that it exhibited: a much less alpha-helical, less beta, but much more disordered structure; a lower proportion of aspartate, isoleucine, leucine, phenylalanine, and lysine, but a higher proportion of proline, glycine, and threonine; and a much higher content of sialic acid. These results indicate that apo[a] is not a superglycosylated form of apoB but is distinctly different in its composition and structure.     

Glucuronides of monohydroxylated bile acids: specificity of microsomal glucuronyltransferase for the glucuronidation site, C-3 configuration, and side chain length

The ability of rat liver microsomes to catalyze UDP-glucuronic acid-dependent glucuronidation of monohydroxy-bile acids was examined. The following bile acids were used as substrates, each as the 3 alpha and 3 beta epimer: 3-hydroxy-5 beta-cholanoic acid (C24), 3-hydroxy-5 beta-norcholanoic acid (C23), 3-hydroxy-5 beta-bisnorcholanoic acid (C22), 3-hydroxy-5 beta-pregnan-21-oic acid (C21), and 3-hydroxy-5 beta-androstane-17 beta-carboxylic acid (C20). The corresponding glucuronides were chemically synthesized to serve as standards and were characterized by thin-layer and gas-liquid chromatography as well as by nuclear magnetic resonance. Enzymatic glucuronidation reactions were optimized with respect to pH for each product formed and the kinetic parameters for each reaction were measured. Analytical techniques necessary to separate products from unreacted substrates and to identify them included thin-layer chromatography, gas-liquid chromatography, and nuclear magnetic resonance. It was found that the 3 alpha epimers of the five bile acids listed above enzymatically formed 3-O-glucuronides, C24 being the best substrate, followed by C21 and C20; C22 and C23 gave rise to only small amounts of this product. The 3 beta epimers of all bile acids tested were poorer substrates, although by a factor that varied widely. In addition to the expected hydroxyl-linked glucuronide, three of the 3 alpha-bile acids (C23, C22, and C20) and at least one 3 beta-bile acid (C20), gave rise to a novel metabolite in which the 1-OH of glucuronic acid was esterified with the steroidal carboxyl group (carboxyl-linked glucuronide).     

Enhancement of water status by calcium pretreatment in groundnut and cowpea plants subjected to moisture stress

Summary The effect of calcium in the water relations and tolerance to moisture deficits was tested in groundnut and cowpea. In both species, enrichment of tissue with calcium resulted in maintenance of a higher water status under stress associated with low proline accumulation. The extent of membrane damage (as reflected by the absorbance at 273 nm) was lesser in leaves of plants fed with higher levels of Ca⁺⁺ when subjected to simulated stress. The rate of water loss from the leaves of Ca⁺⁺-enriched plants was also lower. The possible role of Ca⁺⁺ in inducing membrane stability and maintenance of higher water status is discussed.     

Excretion of cholate glucuronide

[3-3H]Cholic acid glucuronide [7 alpha,12 alpha-dihydroxy-3 alpha-O-(beta-D-glucopyranosyluronate)-5 beta- cholan-24-oate] was synthesized and administered to rats prepared with either an external biliary fistula or a ligated bile duct. When bile fistula animals were given either microgram or milligram amounts of the glucuronide, biliary secretion of label was rapid and efficient: greater than 90% of the administered label was secreted within 60 min and total recovery of label in bile was 98.6 +/- 1.2%. Studies in which [14C]taurocholate was included in the dose indicated that this bile acid was secreted into bile significantly more rapidly than was the glucuronide. In animals with ligated bile ducts, urinary excretion was the major route of elimination: after 20 hr, 83.4 +/- 9.3% of the administered dose had been excreted in urine. Urinary excretion of cholate glucuronide was significantly more rapid than that of taurocholate. Gas-liquid chromatographic analysis of the methyl ester acetate derivatives of labeled compounds isolated from bile and urine by chromatography established that the bulk (greater than 70%) of the administered material was secreted in bile or excreted in urine as the intact cholate glucuronide. From these results, we conclude that the glucuronidation of cholic acid produces a derivative which is rapidly and effectively cleared from the circulation and excreted.     

Stabilized bubbles in the body: pressure-radius relationships and the limits to stabilization

Van Liew, Hugh D., and Soumya Raychaudhuri. Stabilizedbubbles in the body: pressure-radius relationships and the limits tostabilization. J. Appl. Physiol.82(6): 2045-2053, 1997.We previously outlined the fundamentalprinciples that govern behavior of stabilized bubbles, such as themicrobubbles being put forward as ultrasound contrast agents. Ourpresent goals are to develop the idea that there are limits to thestabilization and to provide a conceptual framework for comparison ofbubbles stabilized by different mechanisms. Gases diffuse in or out ofstabilized bubbles in a limited and reversible manner in response tochanges in the environment, but strong growth influences will cause thebubbles to cross a threshold into uncontrolled growth. Also, bubblesstabilized by mechanical structures will be destroyed if outsideinfluences bring them below a critical small size. The in vivo behaviorof different kinds of stabilized bubbles can be compared by using plotsof bubble radius as a function of forces that affect diffusion of gasesin or out of the bubble. The two ends of the plot are the limits forunstabilized growth and destruction; these and the curve's slopepredict the bubble's practical usefulness for ultrasonic imaging orO₂ carriage to tissues.

     

Alkaline phosphatase and acid phosphatase levels in saliva and serum of patients with healthy periodontium,gingivitis, and periodontitis before and after scaling with root planing: A clinico-biochemical study

Periodontitis is commonly diagnosed based on clinical parameters. However, the analysis of a few unique biomarkers of the disease process present in the saliva and blood can further assist the estimation of the rate of disease progression.AimThe present study attempted to correlate the alkaline phosphatase (ALP) and acid phosphatase (ACP) levels in saliva and serum between patients with healthy periodontium, gingivitis, and chronic periodontitis.Materials and methodsThe present study was conducted in 135 subjects between 20 and 55 years of age. The subjects were divided into three groups, namely healthy (Group A), gingivitis (Group B), and chronic periodontitis (Group C). The clinical parameters were recorded using the plaque index (PI), gingival index (GI), and probing depth (PD). Saliva and serum were analyzed for ALP and ACP levels using an auto analyzer. All patients underwent scaling and root planning (SRP) along with oral hygiene instructions. Patients were then recalled after four weeks, and blood and saliva samples were collected to estimate ALP and ACP levels prior to clinical examination.ResultsThe clinical parameters exhibited a statistically significant decrease in the PI and GI in both group B and group C after SRP. A significant change in the PD and attachment levels (AL) was observed in the periodontitis group after SRP. The mean salivary & serum ALP levels exhibited a statistically significant decrease in group B & C after SRP. The mean serum ACP levels exhibited a statistically significant decrease in group B & C after SRP However, the salivary ACP levels decrease after SRP was only statistically significant in group C.ConclusionSerum and salivary ALP and ACP levels were markedly decreased in the gingivitis and periodontitis groups after SRP and were positively correlated with the clinical parameters.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Recognition of viral RNA stem–loops by the tandem double-stranded RNA binding domains of PKR

In humans, the double-stranded RNA (dsRNA)-activated protein kinase (PKR) is expressed in late stages of the innate immune response to viral infection by the interferon pathway. PKR consists of tandem dsRNA binding motifs (dsRBMs) connected via a flexible linker to a Ser/Thr kinase domain. Upon interaction with viral dsRNA, PKR is converted into a catalytically active enzyme capable of phosphorylating a number of target proteins that often results in host cell translational repression. A number of high-resolution structural studies involving individual dsRBMs from proteins other than PKR have highlighted the key features required for interaction with perfectly duplexed RNA substrates. However, viral dsRNA molecules are highly structured and often contain deviations from perfect A-form RNA helices. By use of small-angle X-ray scattering (SAXS), we present solution conformations of the tandem dsRBMs of PKR in complex with two imperfectly base-paired viral dsRNA stem–loops; HIV-1 TAR and adenovirus VA_I-AS. Both individual components and complexes were purified by size exclusion chromatography and characterized by dynamic light scattering at multiple concentrations to ensure monodispersity. SAXS ab initio solution conformations of the individual components and RNA–protein complexes were determined and highlight the potential of PKR to interact with both stem and loop regions of the RNA. Excellent agreement between experimental and model-based hydrodynamic parameter determination heightens our confidence in the obtained models. Taken together, these data support and provide a framework for the existing biochemical data regarding the tolerance of imperfectly base-paired viral dsRNA by PKR.