New Computational Approach for Peptide Vaccine Design Against SARS-COV-2

International Journal of Peptide Research and Therapeutics - The design for vaccines using in silico analysis of genomic data of different viruses has taken many different paths, but lack of any...     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Antifungal Signature: Physicochemical and Structural In Silico Analysis of Some Antifungal Peptides

High throughput screening of antifungal peptide libraries have generated large number of information on peptide activities. However scientists are still struggling to explain the specific antifungal protein motifs resulting in their activities. So a thorough antifungal peptide optimization is required. To design and predict secondary structure of synthetic as well as natural antifungal peptide using in silico approaches, various parameters such as their sequences, physicochemical characterization, structures and functions should taken care to ensure a successful prediction. The primary interest of this study is to determine the properties that stabilize bonds of helices and coils of antifungal peptides along with their domains. Fifty different antifungal peptides have been analyzed in this study which were retrieved from uniprot and pdb databases and were characterized thoroughly using in silico tools. The present analysis showed that most of the antifungal peptides were hydrophobic in nature due to high content of nonpolar residues where as the functional domains were hydrophilic because of the presence of more polar residues. Many disulphide bonds were noticed in these peptides because of the presence of high cysteine residues which may be regarded as a positive factor for stability of linear helices and coils. Maximum number of random coils were observed in the domains of the studied peptides. The present study thus indicated that the peptidal domains of antifungal peptides contain structurally conserve signature though they are evolutionary diverse. Thus the present in silico models are able to guide the antifungal peptide design in a meaningful way.     

Structural basis for the secretion of EvpC: a key type VI secretion system protein from Edwardsiella tarda

The recently identified type VI secretion system (T6SS) is implicated in the virulence of many Gram-negative bacteria. Edwardsiella tarda is an important cause of hemorrhagic septicemia in fish and also gastro- and extra-intestinal infections in humans. The E . tarda virulent protein (EVP) gene cluster encodes a conserved T6SS which contains 16 open reading frames. EvpC is one of the three major EVP secreted proteins and shares high sequence similarity with Hcp1, a key T6SS virulence factor from Pseudomonas aeruginosa. EvpC contributes to the virulence of E. tarda by playing an essential role in functional T6SS. Here, we report the crystal structure of EvpC from E. tarda PPD130/91 at a 2.8 Å resolution, along with functional studies of the protein. EvpC has a β-barrel domain with extended loops. The β-barrel consists of 11 anti-parallel β-strands with an α-helix located on one side. In solution, EvpC exists as a dimer at low concentration and as a hexamer at higher concentration. In the crystal, the symmetry related EvpC molecules form hexameric rings which stack together to form a tube similar to Hcp1. Structure based mutagenesis revealed that N-terminal negatively charged residues, Asp4, Glu15 and Glu26, and C-terminal positively charged residues, Lys161, Lys162 and Lys163, played crucial roles in the secretion of EvpC. Moreover, the localization study indicates the presence of wild type EvpC in cytoplasm, periplasm and secreted fractions, whereas the N-terminal and C-terminal mutants were found mostly in the periplasmic region and was completely absent in the secreted fraction. Results reported here provide insight into the structure, assembly and function of EvpC. Further, these findings can be extended to other EvpC homologs for understanding the mechanism of T6SS and targeting T6SS mediated virulence in Gram-negative pathogens.     

4-Hydroxytamoxifen sulfation metabolism

Tamoxifen (TAM) is an important chemotherapeutic agent for the treatment of breast cancer. It has also been shown to decrease breast cancer incidence in healthy women at high risk for the disease. The increased risk of endometrial cancer in women has raised concerns in the use of the drug. Tamoxifen has also been shown to be a potent hepatocarcinogen in rats. The oxidative metabolites of TAM include alpha-hydroxytamoxifen (alpha-OH-TAM) and 4-hydroxytamoxifen (4-OH-TAM). The studies on the sulfation of these metabolites are very limited. It has been reported that alpha-OH-TAM is a substrate for rat hydroxysteroid sulfotransferase a (STa). Our studies on the sulfation of 4-OH-TAM demonstrated that 4-hydroxytamoxifen can be sulfated by human liver and human intestinal cytosols. Human phenol-sulfating sulfotransferase and human estrogen sulfotransferase are the major enzymes for the sulfation of 4-OH-TAM. Human dopamine-sulfating sulfotransferase also has sulfation activity for 4-OH-TAM. In contrast, rat liver and intestine cytosols have no detectable sulfation activity for 4-OH-TAM. The results suggest that the alpha-OH-TAM sulfation pathway leads to bioactivation of TAM, and the 4-OH-TAM sulfation pathway leads to detoxification of TAM. This agrees with the fact that TAM is more toxic for rats than for human beings.     

ACE/ACE2 balance might be instrumental to explain the certain comorbidities leading to severe COVID-19 cases

The outbreak of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) is a global catastrophe. The elderly and people with comorbidity are facing a serious complication of the disease. The entry and infection strategy of SARS-CoV-2 in a host cell is raised by an amazing way of angiotensin-converting enzyme (ACE) 2 (ACE2) receptor recognition and imbalance of ACE/ACE2 in various organs, especially in the lungs. Here it has been discussed the role of interferon and protease during the receptor recognition (begining of infection) and followed by the impact of cytokine and hypoxia in the context of the balance of ACE/ACE2. It has also very concisely delineated the biochemistry and mechanism of ACE/ACE2 balance in different stages of infection and its role in comorbidity.     

NEMO ensures signaling specificity of the pleiotropic IKKβ by directing its kinase activity toward IκBα

Besides activating NFκB by phosphorylating IκBs, IKKα/IKKβ kinases are also involved in regulating metabolic insulin signaling, the mTOR pathway, Wnt signaling, and autophagy. How IKKβ enzymatic activity is targeted to stimulus-specific substrates has remained unclear. We show here that NEMO, known to be essential for IKKβ activation by inflammatory stimuli, is also a specificity factor that directs IKKβ activity toward IκBα. Physical interaction and functional competition studies with mutant NEMO and IκB proteins indicate that NEMO functions as a scaffold to recruit IκBα to IKKβ. Interestingly, expression of NEMO mutants that allow for IKKβ activation by the cytokine IL-1, but fail to recruit IκBs, results in hyperphosphorylation of alternative IKKβ substrates. Furthermore IKK's function in autophagy, which is independent of NFκB, is significantly enhanced without NEMO as IκB scaffold. Our work establishes a role for scaffolds such as NEMO in determining stimulus-specific signal transduction via the pleiotropic signaling hub IKK.