The use of thioesterase II as a rat mammary epithelial cell-specific marker

The avidin-biotin-peroxidase complex immunoperoxidase technique was employed to determine the intercellular distribution of thioesterase II in rat mammary glands. This enzyme is responsible for shifting the product specificity of the fatty-acid synthetase enzyme complex from long to medium chain fatty acids. Thioesterase II was found exclusively in the cells lining the lumen of the ductal and alveolar structures in glands from mature virgin (150 days old) and pregnant rats. The ductal cell staining intensity was considerably less than that of the alveolar cells in the mature virgin rat glands. No immunoreactive thioesterase II was found in the stromal, adipose, vascular, or myoepithelial components of the gland in the developmental stages examined. In the glands from immature virgin rats (40-45 days old) thioesterase II was again found only in the epithelial cells lining the lumen of the ductal and end-bud structures although this layer was usually more than one cell thick. Quantitative determination of thioesterase II activity in cytosol preparations revealed similar levels in mammary fragments from enzymatically-dissociated glands obtained from mature virgins and in end buds derived from immature virgins, but somewhat higher levels in mammary structures derived from late-pregnant animals. These immunohistological and biochemical results demonstrate thioesterase II's usefulness as a mammary epithelial cell-specific marker.     

In vivo growth stimulation of collagen gel embedded normal human and mouse primary mammary epithelial cells

A new system for studying growth of normal human mammary epithelial cells in an in vivo environment using athymic nude mice is described. Human mammary epithelial cells dissociated from reduction mammoplasty specimens were embedded within collagen gels and subsequently transplanted subcutaneously into nude mice. Histological sections of recovered collagen gels showed epithelial cells arranged as short tubules with some branching. Proliferation of mammary epithelial cells was quantitated in vivo by 3 days' continuous infusion with 5 bromo-2′-deoxy-uridine followed by immunostaining of sections from recovered gels. Ovarian steroids administered to the host animals, resulting in blood serum levels normally found in the human female, had little or no effect on the proliferation of human mammary epithelial cells. Collagen gel embedded mouse mammary epithelial cells, mouse mammary explants, and host mammary glands all responded similarly to ovarian steroids, suggesting that the unresponsiveness of the human mammary epithelial cells under these conditions was not due to dissociation per se. However, an increased dose of 17β-estradiol or a growth factor combination containing epidermal growth factor, cholera toxin, and cortisol significantly stimulated the proliferation of human outgrowths. The growth factor response was dependent on the location of the cells, with the greatest response seen in the part of the gel proximal to the osmotic pump delivering the growth factors and the effect gradually waning in area more distal to the pump. The effect was especially striking since the mitotic figures could be easily identified and the labeling index was as high as 75%. The host mouse mammary gland also responded to growth factors, resulting in ductal hyperplasia. The proliferative and morphogenetic effects of various agents on normal human mammary epithelial cells embedded in collagen gel can be studied in vivo in nude mice. © 1995 Wiley-Liss, Inc.     

Zur Resorption von Calcium und Strontium im Dünndarm von Ratte,Maus und Meerschweinchen

The possible modes of permeation of Ca and Sr through the intestinal epithelium are discussed. The problems of the diffusion and the active transport were studied with prepared bags of duodenum, jejunum and ileum of normal but still immature animals (both sexes) in the Warburg apparatus, at body temperature and in some cases at 4° C. Active transport occurs under oxygen, whereas under nitrogen and blockade of the metabolism with cyanide, only diffusion takes place. Isotopes (⁴⁵Ca and⁹⁰Sr) of high specific activity were used. The diffusion of both elements shows the same ratio at low and at body temperature, with an higher intensity of course at 38° C. This ratio (Ca/Sr) is approximately 3 in the duodenum and in the proximal parts of the jejunum; in the distal parts of the intestine, it is approximately 2 or lower. During active transport there is no alteration in these ratios within the serosa in the tissue. Therefore the selection between the two elements takes place immediatly at the entrance in the mucosa. There are only small and negligible differences between rats and mice. In the intestine of guinea pigs, however, a remarkably higher permeation of Ca and lower retention in the tissue, and consequently higher quotients for Ca/Sr, can be observed. The application of Ca-salts (gluconate, lactate) enhances the permeation of Ca and diminishes the entrance of Sr in all animals. The fact that this alteration takes place during conditions of diffusion as well as of active transport supports the assumption that the selection is preferably dependent upon the differences of the physical state of the two ions (atom volume, hydratation of the ions) rather than on their chemical properties.     

Poly ethylene glycol mediated in vitro screening and physico-biochemical changes induced in mango callus due to moisture stress

Plant Cell, Tissue and Organ Culture (PCTOC) - A method for in vitro screening and selection of drought (moisture stress) tolerant mango calli was developed. Poly ethylene glycol (PEG) (Molecular...     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Induction of male and female sterility in isabgol (<Emphasis Type="Italic">Plantago ovata</Emphasis>) due to floral infection of downy mildew (<Emphasis Type="Italic">Pernospora plantaginis</Emphasis>)

Downy mildew (Peronospora plantaginis) caused two different types of infection in the floral parts of isabgol (Plantago ovata). Systemic infection resulted in long spikes bearing weak and sterile florets, which later turned black due to saprophytic growth. Localised infection produced various symptoms ranging between normal flower opening and failure to bloom. Different parts of infected flowers such as sepal, petal, filament and anther were reduced in size compared to healthy flowers. However, gynoecium was elongated in localised infection. P. plantaginis induced gradual sterility of isabgol flowers. Androecium was affected more than the gynoecium was. Pollen number, pollen viability and germination reduced drastically due to localised infection. On the contrary, there were no significant differences between healthy and locally infected flowers in terms of stigma receptivity. In systemically infected spikes, bud development was arrested leading to sterility. When localised disease severity was high, secondary systemic infection caused similar symptoms. Microscopic observations showed presence of the pathogen in different parts of the flowers. Downy mildew adversely affected seed yield and quality; producing seeds, which were smaller and lighter than the healthy ones and later, became black. Seed yield was reduced by as much as 73.45 percent. Husk content per unit seed mass increased relatively as the total surface area of infected seeds increased.     

X-ray analysis of Mycobacterium smegmatis Dps and a comparative study involving other Dps and Dps-like molecules

The structure of the DNA binding protein from starved cells from Mycobacterium smegmatis has been determined in three crystal forms and has been compared with those of similar proteins from other sources. The dodecameric molecule can be described as a distorted icosahedron. The interfaces among subunits are such that the dodecameric molecule appears to have been made up of stable trimers. The situation is similar in the proteins from Escherichia coli and Agrobacterium tumefaciens, which are closer to the M.smegmatis protein in sequence and structure than those from other sources, which appear to form a dimer first. Trimerisation is aided in the three proteins by the additional N-terminal stretches that they possess. The M.smegmatis protein has an additional C-terminal stretch compared to other related proteins. The stretch, known to be involved in DNA binding, is situated on the surface of the molecule. A comparison of the available structures permits a delineation of the rigid and flexible regions in the molecule. The subunit interfaces around the molecular dyads, where the ferroxidation centres are located, are relatively rigid. Regions in the vicinity of the acidic holes centred around molecular 3-fold axes, are relatively flexible. So are the DNA binding regions. The crystal structures of the protein from M.smegmatis confirm that DNA molecules can occupy spaces within the crystal without disturbing the arrangement of the protein molecules. However, contrary to earlier suggestions, the spaces do not need to be between layers of protein molecules. The cubic form provides an arrangement in which grooves, which could hold DNA molecules, criss-cross the crystal.