Functional assignment to JEV proteins using SVM

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP).     

Tracing paternal ancestry in mice, using the Y-linked, sex-determining locus, Sry

The molecular evolution of mammalian Y-linked DNA sequences is of special interest because of their unique mode of inheritance: most Y- linked sequences are clonally inherited from father to son. Here we investigate the use of Y-linked sequences for phylogenetic inference. We describe a comparative analysis of a 515-bp region from the male sex- determining locus, Sry, in 22 murine rodents (subfamily Murinae, family Muridae), including representatives from nine species of Mus, and from two additional murine genera--Mastomys and Hylomyscus. Percent sequence divergence was < 0.01% for comparisons between populations within a species and was 0.19%-8.16% for comparisons between species. Our phylogenetic analysis of 12 murine taxa resulted in a single most- parsimonius tree that is highly concordant with phylogenies based on mitochondrial DNA and allozymes. A total evidence tree based on the combined data from Sry, mitochondrial DNA, and allozymes supports (1) the monophyly of the subgenus Mus, (2) its division into a Palearctic group (M. musculus, M. domesticus, M. spicilegus, M. Macedonicus, and M. spretus) and an Oriental group (M. cookii++, M. cervicolor, and M. caroli), and (3) sister-group relationships between M. spicilegus and M. macedonicus and between M. cookii and M. cervicolor. We argue that Y- chromosome DNA sequences represent a valuable new source of characters for phylogenetic inference.      

Effect of stocking density on growth and survival of Clarias batrachus (Linn.) larvae and fry during hatchery rearing

Experiments were conducted to determine optimum stocking density for Clarias batrachus larvae and fry during hatchery rearing. The increase in stocking density decreased the total weight, specific growth rate (SGR) and percent weight gain of Clarias larvae during a 13‐day experiment. Survival rate was highest at a stocking density of 1000 m^?2 and lowest at 5000 m^?2. Stocking density did not influence the total biomass production of larvae. Clarias batrachus fry performance was studied during a 28‐day hatchery rearing experiment whereby fry stocked at a density of 100 m^?2 attained the highest total body weight (P < 0.05). The survival rate greatly declined to 59–61% by a density increase to 300 m^?2 and above. Stocking density influenced growth and survival of C. batrachus larvae and fry during hatchery rearing. The best performance was obtained when larvae were stocked at 2000 m^?2; survival was highest with C. batrachus fry stocked at 200 m^?2.     

Biodecolourization of azo and triphenylmethane dyes by <Emphasis Type="Italic">Dichomitus squalens</Emphasis> and <Emphasis Type="Italic">Phlebia</Emphasis> spp

Nine white-rot fungal strains were screened for biodecolourization of brilliant green, cresol red, crystal violet, congo red and orange II. Dichomitus squalens, Phlebia fascicularia and P. floridensis decolourized all of the dyes on solid agar medium and possessed better decolourization ability than Phanerochaete chrysosporium when tested in nitrogen-limited broth medium. Journal of Industrial Microbiology & Biotechnology (2002) 28, 201–203 DOI: 10.1038/sj/jim/7000222 Received 12 July 2001/ Accepted in revised form 22 October 2001     

Exploration of highly selective fluorogenic ‘on–off' chemosensor for H2PO4− ions: ICT‐based sensing and ATPase activity profiling

Abstract In this study, the recognition contour of Chemosensor 1 was investigated using semiaqueous methanol (X_H, mole fraction = 0.31) for a range of anions and bioactive species. Host–receptor signalling based on the internal charge transfer mechanism for Chemosensor 1 was explored and reported. Structure of Chemosensor 1 and its plausible anion coordination based on hydrogen bonding is complemented with density functional theory. Consequently, we investigated the applicability of the synthesized probe in blood plasma, urine, tap water samples, and for monitoring of ATP in lysosomes by apyrase enzyme.     

Economic and environmental impact assessments of a stand-alone napier grass-fired combined heat and power generation system in the southeastern US

The International Journal of Life Cycle Assessment - Napier grass, one of the high yield perennial energy crops can be grown on marginal lands with minimal inputs, but with increased soil carbon...     

Stop codon read-through of mammalian MTCH2 leading to an unstable isoform regulates mitochondrial membrane potential

Stop codon read-through (SCR) is a process of continuation of translation beyond a stop codon. This phenomenon, which occurs only in certain mRNAs under specific conditions, leads to a longer isoform with properties different from that of the canonical isoform. MTCH2, which encodes a mitochondrial protein that regulates mitochondrial metabolism, was selected as a potential read-through candidate based on evolutionary conservation observed in the proximal region of its 3′ UTR. Here, we demonstrate translational read-through across two evolutionarily conserved, in-frame stop codons of MTCH2 using luminescence- and fluorescence-based assays, and by analyzing ribosome-profiling and mass spectrometry (MS) data. This phenomenon generates two isoforms, MTCH2x and MTCH2xx (single- and double-SCR products, respectively), in addition to the canonical isoform MTCH2, from the same mRNA. Our experiments revealed that a cis-acting 12-nucleotide sequence in the proximal 3′ UTR of MTCH2 is the necessary signal for SCR. Functional characterization showed that MTCH2 and MTCH2x were localized to mitochondria with a long t_1/2 (>36 h). However, MTCH2xx was found predominantly in the cytoplasm. This mislocalization and its unique C terminus led to increased degradation, as shown by greatly reduced t_1/2 (<1 h). MTCH2 read-through–deficient cells, generated using CRISPR-Cas9, showed increased MTCH2 expression and, consistent with this, decreased mitochondrial membrane potential. Thus, double-SCR of MTCH2 regulates its own expression levels contributing toward the maintenance of normal mitochondrial membrane potential.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.