Life-cycle assessment and techno-economic analysis of biochar produced from forest residues using portable systems

The International Journal of Life Cycle Assessment - Producing biochar from forest residues can help resolve environmental issues by reducing forest fires and mitigating climate change. However,...     

Effect of metal coordination and intra-molecular H-bond on the acidity of phenolic proton in a set of structurally characterized octahedral Ni(II) complexes of l-histidine derivative

Four different mononuclear octahedral Ni(II) complexes with protonated and deprotonated form of the same ligand have been synthesized by controlling reaction conditions and structurally characterized. The complexes are [Ni(HL^l-his)(benzoate)(MeOH)] (1), [Ni(HL^l-his)(SCN)(MeOH)] (2), [Ni(HL^l-his)₂] (3) and [Ni(L^l-his)(imidazole)₂] (4) where H₂L^l-his is (S)-2-(2-hydroxybenzylamino)-3-(1H-imidazol-4-yl)-propionic acid. The ligand behaves as a monobasic tetradentate ligand in 1 and 2, monobasic tridentate ligand in 3 and dibasic tetradentate ligand in 4. Ni(II) coordinated phenolic proton of the ligand in the complexes 1-2 shows strong intra-molecular H-bonding with benzoate in 1 and lattice water in 2, whereas 3 shows intermolecular H-bonding between uncoordinated phenols with neighbouring carboxylate. The pH titration of the complexes revealed that metal coordination and H-bond in complexes 1 and 2 considerably lowers the acidity of ligand phenol (pK_a 6.8 and 7.0 respectively) compared to phenol (pK_a 10). The complex 4 does not show any proton loss due to the absence of phenolic proton. All the complexes show extensive H-bonded network in the crystals including narrow (7.8 × 5.2 Å) water filled one dimensional channel in 2.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Carbonic anhydrase I and II inhibition with natural products: caffeine and piperine

Novel chemotypes with carbonic anhydrase (CA; EC 4.2.1.1) inhibitory action, in addition to the sulphonamide and sulphamate were discovered, many of which are based on natural products. Caffeine and piperine were extracted and tested for inhibition of the human (h) cytosolic isoforms hCA I and II. The IC(50) values of caffeine against hCA I was of 55?mM, whereas that of piperine of 60?mM. The IC(50) values of caffeine and piperine against hCA II were of 2?mM. Although these are quite weak inhibitors they may constitute leads for developing tighter binding compounds.     

Heteroglucan-dendrimer glycoconjugate: a modulated construct with augmented immune responses and signaling phenomena

Background

Newer strategies for augmenting immune responses of pharmacologically active glucans may serve to improve the medicinal potential of these biomolecules. With this aim, the present work was focused on generating targeted high molecular size glucan particles with magnified immune response activity.

Methods

Heteroglucans were conjugated with PAMAM dendrimers using a Schiff base reductive amination reaction to generate a polytethered molecule with multiple glucan motifs. The modulated construct was characterized by FTIR, TEM, ¹H NMR and dynamic light scattering (DLS) methods. Effects of conjugated glucans were examined in RAW 264.7 macrophage cells as well as in S-180 murine tumor models.

Results

Dendrimer-conjugated glucans were found to exhibit a two-fold increase in immune stimulation in comparison to unconjugated glucans. This may be corroborated by the predominant enhancement in immunological functions such as nitric oxide production, ROS generation and immune directed tumor inhibition in murine models. Immune cell surface markers (CD4, CD8, CD19, MHC-II) and cytokine levels were also found to be highly up-regulated in the splenocytes of mice subjected to particulate glucan administration. Our study also demonstrated that conjugated glucan treatment to RAW 264.7 cells strongly enhanced the phosphorylation of two downstream signalling molecules of the mitogen activated protein kinase (MAPKs) family: p38 and MEK1/2 relative to single glucans thereby relating molecular mechanisms with enhanced immune stimulation.

Conclusions and general significance

The results obtained thus support that particulate format of soluble heteroglucan will thereby improve its functionality and identify leads in therapeutic competence.     

Analysing diversity among Indian isolates of Anabaena (Nostocales, Cyanophyta) using morphological, physiological and biochemical characters

A set of 24 strains belonging to the genus Anabaena (Phylum Cyanobacteria), isolated from diverse geographic locations in India, were evaluated along with three International type strains of Anabaena (ATCC 29414, ATCC 29208 and ATCC 27899) for their morphological, physiological and biochemical diversity. The morphological dataset, consisting of 58 variants for 15 characters, and SDS-PAGE protein profiles comprising 17 polymorphic bands were utilized to differentiate the selected Anabaena strains and explore the patterns of diversity through cluster analysis. Physiological and biochemical characterization with respect to nitrogen fixation and accumulation of chlorophyll and phycobiliproteins led to the identification of some highly promising Anabaena strains for use as biofertilizers and source of pigments. The study highlighted the tremendous inter and intraspecific diversity within the Anabaena isolates and indicated the potential as well as constraints of the morphological and protein profiling datasets for unambiguous differentiation and analyses of diversity among the Anabaena strains.