Penetration of C8 and C9 in the C5b-9 complex across the erythrocyte membrane into the cytoplasmic space

We have developed a technique in which transglutaminase is used to measure the penetration of terminal complement proteins across the erythrocyte membrane into the cytoplasmic space. Penetration of a given terminal complement protein into the cytoplasmic space was assessed by labeling the protein of interest with radioactive iodine, forming the complement channel using the labeled protein, adding transglutaminase to only one side of the membrane, and allowing the enzyme to cross-link the susceptible proteins on that side of the membrane. Cross-linking was assessed by measuring the increase in molecular weight of the appropriate molecule on sodium dodecyl sulfate gels under reducing conditions. The results of these experiments indicate that C8 and C9 are rapidly cross-linked to high molecular weight from either the interior or the exterior of the membrane. In order to determine whether the cross-linking mediated by enzyme on the interior was occurring from within the ghosts and not via enzyme that had leaked into the extracellular medium, experiments were performed with dimethylcasein in the extracellular medium. In the presence of this protein, cross-linking of C8 and C9 from outside was negligible. Hence, if cross-linking occurs when transglutaminase is trapped inside the ghosts, it cannot be due to leakage of enzyme, but must be attributable to cross-linking from the inside. The results show that C9 definitely penetrated across the membrane into the intracellular space. With respect to C8, statistical evaluation indicates that C8 probably penetrated into the intracellular space.     

Processes of reconstruction and association by nucleosomes with various formations of histones

The experiments on reconstruction of chromatin (without H1) from DNA and histone octamer containing either H2B from sea urchin sperm (H2B-S) or H2B from calf thymus are reported. It has been shown that H2B-S affects the mode of interaction of histones with DNA during the reconstitution of nucleosomal particles on one hand and on the other hand H2B-S plays a major role in the interactions of reconstituted mononucleosomes. These interactions result in supranucleosomal structures.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Experimentally evolved and phenotypically plastic responses to enforced monogamy in a hermaphroditic flatworm

Sexual selection is considered a potent evolutionary force in all sexually reproducing organisms, but direct tests in terms of experimental evolution of sexual traits are still lacking for simultaneously hermaphroditic animals. Here, we tested how evolution under enforced monogamy affected a suite of reproductive traits (including testis area, sex allocation, genital morphology, sperm morphology and mating behaviour) in the outcrossing hermaphroditic flatworm Macrostomum lignano, using an assay that also allowed the assessment of phenotypically plastic responses to group size. The experiment comprised 32 independent selection lines that evolved under either monogamy or polygamy for 20 generations. While we did not observe an evolutionary shift in sex allocation, we detected effects of the selection regime for two male morphological traits. Specifically, worms evolving under enforced monogamy had a distinct shape of the male copulatory organ and produced sperm with shorter appendages. Many traits that did not evolve under enforced monogamy showed phenotypic plasticity in response to group size. Notably, individuals that grew up in larger groups had a more male‐biased sex allocation and produced slightly longer sperm than individuals raised in pairs. We conclude that, in this flatworm, enforced monogamy induced moderate evolutionary but substantial phenotypically plastic responses.     

Insulin recruits GLUT4 from specialized VAMP2-carrying vesicles as well as from the dynamic endosomal/trans-Golgi network in rat adipocytes

Insulin treatment of fat cells results in the translocation of the insulin-responsive glucose transporter type 4, GLUT4, from intracellular compartments to the plasma membrane. However, the precise nature of these intracellular GLUT4-carrying compartments is debated. To resolve the nature of these compartments, we have performed an extensive morphological analysis of GLUT4-containing compartments, using a novel immunocytochemical technique enabling high labeling efficiency and 3-D resolution of cytoplasmic rims isolated from rat epididymal adipocytes. In basal cells, GLUT4 was localized to three morphologically distinct intracellular structures: small vesicles, tubules, and vacuoles. In response to insulin the increase of GLUT4 at the cell surface was compensated by a decrease in small vesicles, whereas the amount in tubules and vacuoles was unchanged. Under basal conditions, many small GLUT4 positive vesicles also contained IRAP (88%) and the v-SNARE, VAMP2 (57%) but not markers of sorting endosomes (EEA1), late endosomes, or lysosomes (lgp120). A largely distinct population of GLUT4 vesicles (56%) contained the cation-dependent mannose 6-phosphate receptor (CD-MPR), a marker protein that shuttles between endosomes and the trans-Golgi network (TGN). In response to insulin, GLUT4 was recruited both from VAMP2 and CD-MPR positive vesicles. However, while the concentration of GLUT4 in the remaining VAMP2-positive vesicles was unchanged, the concentration of GLUT4 in CD-MPR-positive vesicles decreased. Taken together, we provide morphological evidence indicating that, in response to insulin, GLUT4 is recruited to the plasma membrane by fusion of preexisting VAMP2-carrying vesicles as well as by sorting from the dynamic endosomal-TGN system.