Les génotypes responsables de mucoviscidose ou d’absence bilatérale des canaux déférents ABCD

Over the last decade, the genetic basis for CBAVD has been identified by its association with CFTR gene mutations, and CBAVD is now generally considered to be a mild or incomplete form of CF. In this review, the author summarizes the main results of compilation of CFTR gene analysis conducted in French laboratories for 3,923 patients with CF and 800 males with CABVD. The degree of clinical expression can be affected by several variables, including the molecular mechanisms by which the various CFTR mutations impair or disrupt the function of the CFTR chloride channel. Phenotypic expression of CFTR mutational genotypes varies from severe, progressive pulmonary disease with pancreatic insufficiency (CF-PI), to mild pulmonary disease with pancreatic sufficiency (PS) or singleorgan forms of “CFTR-opathies”. In CF, a total of 310 different CFTR mutations accounting for 94% of 7,846 CF alleles have generated almost 500 different genotypes, comprising 2 severe mutations in 88% of cases (CF-PI), one severe mutation in trans to a mild mutation in 11% (CF-PS), and 2 mild mutations in 1% of identified genotypes. In CBAVD, 137 mutations scattered over the whole gene were identified in 60% of 1,600 CBAVD alleles during the study. Among the 150 characterized mutational CFTR genotypes, compound heterozygosity was the rule, and the most frequent CBAVD combinations were ΔF508/5T (35%), ΔF508/other mutation (30%, including ΔF508/R117H-7T: 5,6%), and 5T/other mutation (17%). No combination of two severe mutations was found in CBAVD (0%); by contrast with the CF population, 88% of genotypes identified in CBAVD comprised a severe mutation in trans to a mild mutation, and 12% consisted of 2 mild mutations. A total of 22 genotypes were shared by both CF and CBAVD. The role of the 5T allele as a splicing variant with variable, incomplete disease penetrance in CBAVD is reviewed. Other haplotype backgrounds, such as the TG12 sequence and the M470V polymorphism, may influence CFTR splicing and/or function. This study confirms the high molecular heterogeneity of CFTR mutations in CBAVD and emphasizes the importance of extensive CFTR analysis in these patients. Longterm follow-up studies of CBAVD patients are necessary in order to predict the phenotypic consequences of numerous CFTR mutational genotypes.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Genetic control of wheat quality: interactions between chromosomal regions determining protein content and composition, dough rheology, and sponge and dough baking properties

While the genetic control of wheat processing characteristics such as dough rheology is well understood, limited information is available concerning the genetic control of baking parameters, particularly sponge and dough (S&D) baking. In this study, a quantitative trait loci (QTL) analysis was performed using a population of doubled haploid lines derived from a cross between Australian cultivars Kukri × Janz grown at sites across different Australian wheat production zones (Queensland in 2001 and 2002 and Southern and Northern New South Wales in 2003) in order to examine the genetic control of protein content, protein expression, dough rheology and sponge and dough baking performance. The study highlighted the inconsistent genetic control of protein content across the test sites, with only two loci (3A and 7A) showing QTL at three of the five sites. Dough rheology QTL were highly consistent across the 5 sites, with major effects associated with the Glu-B1 and Glu-D1 loci. The Glu-D1 5 + 10 allele had consistent effects on S&D properties across sites; however, there was no evidence for a positive effect of the high dough strength Glu-B1-al allele at Glu-B1. A second locus on 5D had positive effects on S&D baking at three of five sites. This study demonstrated that dough rheology measurements were poor predictors of S&D quality. In the absence of robust predictive tests, high heritability values for S&D demonstrate that direct selection is the current best option for achieving genetic gain in this product category. Electronic supplementary material  The online version of this article (doi:) contains supplementary material, which is available to authorized users.     

Immunochemically detectable phytochrome is present at normal levels but is photochemically nonfunctional in the hy 1 and hy 2 long hypocotyl mutants of Arabidopsis

The hy 1 and hy 2 long hypocotyl mutants of Arabidopsis thaliana contain less than 20% (the detection limit) of the phytochrome in wild-type tissue as measured by in vivo difference spectroscopy. In contrast, spectral measurements for the hy 3, hy 4, and hy 5 long hypocotyl mutants indicate that they each contain levels of phytochrome equivalent to the wild-type parent. Immunoblot analysis using a monoclonal antibody directed against the chromophore-bearing region of etiolated-oat phytochrome demonstrates that extracts of all mutant and wild-type Arabidopsis tissues, prepared by extraction of proteins into hot SDS-containing buffer, have identical levels of one major immunodetectable protein (116 kDa). An assay involving controlled in vitro proteolysis, known to produce distinctive fragmentation patterns for Pr and Pfr (Vierstra RD, Quail PH, Planta 156: 158–165, 1982), indicates that the 116 kDa polypeptide from the wild-type parent represents Arabidopsis phytochrome. The 116 kDa protein from either hy 3, hy 4, or hy 5 displays the same fragmentation pattern found for the wild type. Together with the spectral data, these results indicate that the mutant phenotype of these variants does not involve lesions in the polypeptide sequence that lead to gross conformational aberrations, and suggest that the genetic lesions may affect steps in the transduction chain downstream of the photoreceptor. In contrast, this same analysis for hy 1 and hy 2 has revealed that the 116 kDa protein from either of these mutants is not degraded differently in response to the different wavelengths of irradiation given in vitro. Moreover, whereas immunoblot analysis of tissue extracts from light-grown wild-type seedlings show that the 116 kDa phytochrome protein level is greatly reduced relative to dark-grown tissue as expected, similar extracts of light-grown hy 1 and hy 2 seedlings contain the 116 kDa polypeptide in amounts equivalent to those of dark-grown tissue. Combined, these data indicate that the hy 1 and hy 2 mutants both produce normal levels of immunochemically detectable phytochrome that is photochemically nonfunctional.