Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Genetic control of wheat quality: interactions between chromosomal regions determining protein content and composition, dough rheology, and sponge and dough baking properties

While the genetic control of wheat processing characteristics such as dough rheology is well understood, limited information is available concerning the genetic control of baking parameters, particularly sponge and dough (S&D) baking. In this study, a quantitative trait loci (QTL) analysis was performed using a population of doubled haploid lines derived from a cross between Australian cultivars Kukri × Janz grown at sites across different Australian wheat production zones (Queensland in 2001 and 2002 and Southern and Northern New South Wales in 2003) in order to examine the genetic control of protein content, protein expression, dough rheology and sponge and dough baking performance. The study highlighted the inconsistent genetic control of protein content across the test sites, with only two loci (3A and 7A) showing QTL at three of the five sites. Dough rheology QTL were highly consistent across the 5 sites, with major effects associated with the Glu-B1 and Glu-D1 loci. The Glu-D1 5 + 10 allele had consistent effects on S&D properties across sites; however, there was no evidence for a positive effect of the high dough strength Glu-B1-al allele at Glu-B1. A second locus on 5D had positive effects on S&D baking at three of five sites. This study demonstrated that dough rheology measurements were poor predictors of S&D quality. In the absence of robust predictive tests, high heritability values for S&D demonstrate that direct selection is the current best option for achieving genetic gain in this product category. Electronic supplementary material  The online version of this article (doi:) contains supplementary material, which is available to authorized users.     

Immunochemically detectable phytochrome is present at normal levels but is photochemically nonfunctional in the hy 1 and hy 2 long hypocotyl mutants of Arabidopsis

The hy 1 and hy 2 long hypocotyl mutants of Arabidopsis thaliana contain less than 20% (the detection limit) of the phytochrome in wild-type tissue as measured by in vivo difference spectroscopy. In contrast, spectral measurements for the hy 3, hy 4, and hy 5 long hypocotyl mutants indicate that they each contain levels of phytochrome equivalent to the wild-type parent. Immunoblot analysis using a monoclonal antibody directed against the chromophore-bearing region of etiolated-oat phytochrome demonstrates that extracts of all mutant and wild-type Arabidopsis tissues, prepared by extraction of proteins into hot SDS-containing buffer, have identical levels of one major immunodetectable protein (116 kDa). An assay involving controlled in vitro proteolysis, known to produce distinctive fragmentation patterns for Pr and Pfr (Vierstra RD, Quail PH, Planta 156: 158–165, 1982), indicates that the 116 kDa polypeptide from the wild-type parent represents Arabidopsis phytochrome. The 116 kDa protein from either hy 3, hy 4, or hy 5 displays the same fragmentation pattern found for the wild type. Together with the spectral data, these results indicate that the mutant phenotype of these variants does not involve lesions in the polypeptide sequence that lead to gross conformational aberrations, and suggest that the genetic lesions may affect steps in the transduction chain downstream of the photoreceptor. In contrast, this same analysis for hy 1 and hy 2 has revealed that the 116 kDa protein from either of these mutants is not degraded differently in response to the different wavelengths of irradiation given in vitro. Moreover, whereas immunoblot analysis of tissue extracts from light-grown wild-type seedlings show that the 116 kDa phytochrome protein level is greatly reduced relative to dark-grown tissue as expected, similar extracts of light-grown hy 1 and hy 2 seedlings contain the 116 kDa polypeptide in amounts equivalent to those of dark-grown tissue. Combined, these data indicate that the hy 1 and hy 2 mutants both produce normal levels of immunochemically detectable phytochrome that is photochemically nonfunctional.     

Phytochrome A regulates red-light induction of phototropic enhancement in Arabidopsis.

Phytochrome A (phyA) and phytochrome B photoreceptors have distinct roles in the regulation of plant growth and development. Studies using specific photomorphogenic mutants and transgenic plants overexpressing phytochrome have supported an evolving picture in which phyA and phytochrome B are responsive to continuous far-red and red light, respectively. Photomorphogenic mutants of Arabidopsis thaliana that had been selected for their inability to respond to continuous irradiance conditions were tested for their ability to carry out red-light-induced enhancement of phototropism, which is an inductive phytochrome response. We conclude that phyA is the primary photoreceptor regulating this response and provide evidence suggesting that a common regulatory domain in the phyA polypeptide functions for both high-irradiance and inductive phytochrome responses.