Identification of Tumor Antigens in the HLA Peptidome of Patient-derived Xenograft Tumors in Mouse

1. Download : Download high-res image (147KB)
2. Download : Download full-size image

Highlights

• •Sufficient tumor tissues are often unavailable large HLA peptidome discovery.
• •Using patient derived xenograft (PDX) tumors can overcome this limitation.
• •The large PDX HLA peptidomes expand significantly those of the original biopsies.
• •The HLA peptidomes of the PDX tumors included many tumor antigens.

     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

High-resolution footprints of the DNA-binding domain of Epstein-Barr virus nuclear antigen 1.

The DNA-binding domain of Epstein-Barr virus nuclear antigen 1 was found by hydroxyl radical footprinting to protect backbone positions on one side of its DNA-binding site. The guanines contacted in the major groove by the DNA-binding domain of Epstein-Barr virus nuclear antigen 1 were identified by methylation protection. No difference was found in the interaction of the DNA-binding domain of Epstein-Barr virus nuclear antigen 1 with tandemly repeated and overlapping binding sites.     

Interdependence of the radioprotective effects of human recombinant interleukin 1 alpha, tumor necrosis factor alpha, granulocyte colony-stimulating factor, and murine recombinant granulocyte-macrophage colony-stimulating factor

Interleukin 1 alpha (IL-1 alpha), tumor necrosis factor alpha (TNF alpha), granulocyte-colony-stimulating factor (G-CSF), and granulocyte-macrophage colony-stimulating factor (GM-CSF) are molecularly distinct cytokines acting on separate receptors. The release of these cytokines can be concomitantly induced by the same signal and from the same cellular source, suggesting that they may cooperate. Administered alone, human recombinant (hr)IL-1 alpha and hrTNF alpha protect lethally irradiated mice from death, whereas murine recombinant GM-CSF and hrG-CSF do not confer similar protection. On a dose basis, IL-1 alpha is a more efficient radioprotector than TNF alpha. At optimal doses, IL-1 alpha is a more radioprotective cytokine than TNF alpha in C57BL/6 and B6D2F1 mice and less effective than TNF alpha in C3H/HeN mice, suggesting that the relative effectiveness of TNF alpha and IL-1 alpha depends on the genetic makeup of the host. Administration of the two cytokines in combination results in additive radioprotection in all three strains. This suggests that the two cytokines act through different radioprotective pathways and argues against their apparent redundancy. Suboptimal, nonradioprotective doses of IL-1 alpha also synergize with GM-CSF or G-CSF to confer optimal radioprotection, suggesting that such an interaction may be necessary for radioprotection of hemopoietic progenitor cells.     

Reaction of the antithrombotic and antimetastatic agent, nafazatrom, with oxidizing radicals

Pulse radiolysis and electron spin resonance experiments have been performed on the antithrombotic and antimetastatic agent, nafazatrom. Results show that nafazatrom is an extremely reactive scavenger of free radicals. The rate of its reaction with Br-2 is higher than rates found for biologically important antioxidants, tocopherol and ascorbate. The radical formed by oxidation of nafazatrom is indicated by ESR to have a structure similar to phenoxyl radical. This radical is found to decay at a rate approaching diffusion controlled rates. The ease of oxidation of nafazatrom makes it ideally suited to act as an antioxidant. This property may be an important determinant of its pharmacological activities.     

Studies on the subunit structure and amino acid sequence of triose phosphate isomerase from chicken breast muscle

1. Triose phosphate isomerase was prepared by chromatography on DEAE-cellulose of an (NH(4))(2)SO(4) fraction of an extract of homogenized chicken breast muscle. The product is homogeneous on gel electrophoresis and is suitable for growing crystals for X-ray work. The specific activity is 10000 units/mg and the value for E(0.1%) (280) is 1.20. 2. Comparison between the sum of the amino acid compositions of the tryptic peptides of the protein and the amino acid composition obtained on total hydrolysis of the protein indicates that the relative subunit mass is about 27000. 3. These data, together with the results of the examination of the amino acid compositions of a number of minor peptides, the number of peptides in the tryptic digest and the complete amino acid sequences of the tryptic peptides (the determination of which is described here), give no indication that the subunits are dissimilar. 4. A tentative amino acid sequence is presented for the protein, in which the ordering of the tryptic peptides is derived by homology with the sequence of the rabbit muscle enzyme (Corran & Waley, 1973). 5. An appendix describes the use that was made of mass spectrometry in the determination of some of the sequences. Mass-spectrometric data have been obtained for 35 residues, that is about 15% of the total sequence of the protein. 6. An extended version of the present paper has been deposited as Supplementary Publication SUP 50025 at the British Library, Lending Division (formerly the National Lending Library for Science and Technology), Boston Spa, Yorks. LS23 7BQ, U.K., from whom copies may be obtained on the terms given in Biochem. J. (1973) 131, 5.     

Utility of interleukin-1 in therapy of radiation injury as studied in small and large animal models

Summary and conclusions Our results demonstrate that IL-1 promotes hematopoiesis in normal and radiation compromised animals. IL-1 protected mice from lethal hematopoietic syndrome when given before irradiation. Given after irradiation, IL-1 promoted recovery of mice and primates from radiation injury.A comparison of the effects of IL-1 in three different species indicated that hematopoiesis of mice, monkeys,and dogs is upregulated in a similar fashion by IL-1. These three species, however, vary greatly in their sensitivity to IL-1. Whereas mice and dogs tolerated doses greater than 1000 g/Kg of IL-1, 10 g/Kg of IL-1 in rhesus monkeys resulted in considerable toxic effects.Several activities of IL-1 may explain its bone marrow restorative properties. The induction with IL-1 of several hematopoietic growth factors: GM-CSF, G-CSF, M-CSF, IL 3, and IL 6, clearly contributes to the accelerated growth and differentiation of hematopoietic progenitor cells. The induction of scavenger proteins may serve to reduce post irradiation oxidative damage.Our work raised a number of additional questions concerning the potential therapeutic utility of IL-1. The ability of IL-1 to promote engraftment of allogeneic bone marrow cells will require further study. The optimal dosage, schedule, and route for IL-1 induction of hematopoiesis will need to be established. The observed synergy of IL-1 with TNF, IL 6, or CSF's may be useful in reducing the requisite doses of cytokines from pharmacological to physiological levels with concomitant reduction in toxic effects. The choice of proper cytokine combinations, however, may also be dependent on the clinical status of the patients.     

Transfer of herpes simplex virus thymidine kinase synthesized in bacteria by a high-expression plasmid to tissue culture cells by protoplast fusion.

The introduction of a protein into living tissue culture cells may permit the in vivo study of functions of the protein. We have previously described a high-efficiency-expression plasmid, pHETK2, containing the herpes simplex virus type 1 thymidine kinase (TK) gene which, upon temperature induction, causes TK to be synthesized as greater than 4% of the bacterial protein. In this report we show that enzymatically active TK was transferred to mouse Ltk- cells by polyethylene glycol-mediated fusion with protoplasts prepared from bacteria containing induced levels of TK. The presence of TK in the Ltk- cells was detected by the incorporation of [3H]thymidine into cell nuclei as measured by autoradiography.     

Multiple species of HPRT polypeptides in mouse L cells

Mouse L cells contain three polypeptide species which react with antibody specific for HPRT; loss or diminution of these polypeptides can occur in association with a heritable deficiency in HPRT enzymatic activity. Although HPRT activity is not detectable in deficient A9 cells, two of the three polypeptide species are detectable. Clonal revertant A9 cells which spontaneously regained HPRT activity also have re-acquired apparently normal amounts of all three polypeptide species; by contrast, HPRT-positive A9 cells which acquired the enzymatic activity via human metaphase chromosome transfer exhibited the human polypeptide species characteristic of that expressed in human cells. The heterogeneity exhibited by the mouse HPRT polypeptides suggests that the active mouse enzyme may be subject to a form of modification and/or regulation which is not shared by human HPRT.     

Family studies of hereditary hemochromatosis in Denmark and the Faroe Islands

Summary Pedigree studies were performed based on one Faroese and four Danish probands with overt idiopathic hemochromatosis (IH). The study consisted of HLA typing and determination of biochemical iron status indicators (serum transferrin saturation, serum ferritin). In total, 130 persons were evaluated. The screening identified 6 homozygous (h/h) subjects with preclinical IH, 46 heterozygous (h/n), and 8 normal (n/n) subjects, while 39 subjects were classified as normal or heterozygous (n/h?). One family demonstrated both a homozygous x heterozygous as well as a heterozygous x heterozygous mating. Recombination between the HLA region and IH locus occurred possibly in three subjects in three different families. The significance of detailed screening in families with probands with IH is discussed.