Utilization of siderophores by Candida albicans

Candida albicans secretes both hydroxamate and phenolate-type siderophores when grown under iron-restricted conditions. The inhibition of candidal growth by iron limitation was reversed by the addition of supplemental hydroxamate on phenolate siderophores. Both siderophores produced equal stimulation of growth suggesting that C. albicans could utilize both siderophores with equal efficiency. Addition of heterologous siderophores from both bacteria and fungi also supported growth of the yeast in a deferrated medium. These results suggest that C. albicans has an iron-uptake mechanism which enables it to obtain iron by utilizing candidal and non-candidal siderophores.     

Integrating sample similarities into latent class analysis: a tree-structured shrinkage approach

This paper is concerned with using multivariate binary observations to estimate the probabilities of unobserved classes with scientific meanings. We focus on the setting where additional information about sample similarities is available and represented by a rooted weighted tree. Every leaf in the given tree contains multiple samples. Shorter distances over the tree between the leaves indicate a priori higher similarity in class probability vectors. We propose a novel data integrative extension to classical latent class models with tree-structured shrinkage. The proposed approach enables (1) borrowing of information across leaves, (2) estimating data-driven leaf groups with distinct vectors of class probabilities, and (3) individual-level probabilistic class assignment given the observed multivariate binary measurements. We derive and implement a scalable posterior inference algorithm in a variational Bayes framework. Extensive simulations show more accurate estimation of class probabilities than alternatives that suboptimally use the additional sample similarity information. A zoonotic infectious disease application is used to illustrate the proposed approach. The paper concludes by a brief discussion on model limitations and extensions.     

Successful phytoremediation of crude-oil contaminated soil at an oil exploration and production company by plants-bacterial synergism

Phytoremediation is a promising approach for the cleanup of soil contaminated with petroleum hydrocarbons. This study aimed to develop plant-bacterial synergism for the successful remediation of crude oil-contaminated soil. A consortia of three endophytic bacteria was augmented to two grasses, Leptochloa fusca and Brachiaria mutica, grown in oil-contaminated soil (46.8 g oil kg^?1 soil) in the vicinity of an oil exploration and production company. Endophytes augmentation improved plant growth, crude oil degradation, and soil health. Maximum oil degradation (80%) was achieved with B. mutica plants augmented with the endophytes and it was significantly (P < 0.05) higher than the use of plants or bacteria individually. Moreover, endophytes showed more persistence, the abundance and expression of alkB gene in the rhizosphere as well as in the endosphere of the tested plants than in unvegetated soil. A positive relationship (r = 0.70) observed between gene expression and crude oil reduction indicates that catabolic gene expression is important for hydrocarbon mineralization. This investigation showed that the use of endophytes with appropriate plant is an effective strategy for the cleanup of oil-contaminated soil under field conditions.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Lower Neighborhood Socioeconomic Status Associated with Reduced Diversity of the Colonic Microbiota in Healthy Adults

In the United States, there are persistent and widening socioeconomic gaps in morbidity and mortality from chronic diseases. Although most disparities research focuses on person-level socioeconomic-status, mounting evidence suggest that chronic diseases also pattern by the demographic characteristics of neighborhoods. Yet the biological mechanisms underlying these associations are poorly understood. There is increasing recognition that chronic diseases share common pathogenic features, some of which involve alterations in the composition, diversity, and functioning of the gut microbiota. This study examined whether socioeconomic-status was associated with alpha-diversity of the colonic microbiota. Forty-four healthy adults underwent un-prepped sigmoidoscopy, during which mucosal biopsies and fecal samples were collected. Subjects’ zip codes were geocoded, and census data was used to form a composite indicator of neighborhood socioeconomic-status, reflecting household income, educational attainment, employment status, and home value. In unadjusted analyses, neighborhood socioeconomic-status explained 12–18 percent of the variability in alpha-diversity of colonic microbiota. The direction of these associations was positive, meaning that as neighborhood socioeconomic-status increased, so did alpha-diversity of both the colonic sigmoid mucosa and fecal microbiota. The strength of these associations persisted when models were expanded to include covariates reflecting potential demographic (age, gender, race/ethnicity) and lifestyle (adiposity, alcohol use, smoking) confounds. In these models neighborhood socioeconomic-status continued to explain 11–22 percent of the variability in diversity indicators. Further analyses suggested these patterns reflected socioeconomic variations in evenness, but not richness, of microbial communities residing in the sigmoid. We also found indications that residence in neighborhoods of higher socioeconomic-status was associated with a greater abundance of Bacteroides and a lower abundance of Prevotella, suggesting that diet potentially underlies differences in microbiota composition. These findings suggest the presence of socioeconomic variations in colonic microbiota diversity. Future research should explore whether these variations contribute to disparities in chronic disease outcomes.     

Erratum to: Synthesis and Anticancer Activity of Functionalized Thieno[2,3-d]pyrimidine Compounds and Their Triazinyl and Tetrazinyl Derivatives

Russian Journal of Bioorganic Chemistry - erratum     

Association of polymorphisms in genes involved in enamel formation,taste preference and immune response with early childhood caries in Saudi pre-school children

Dental caries is primarily elicited by modifiable factors such as inadequate oral hygiene, poor dietary practices and deficient fluoride exposure. However, there is a growing body of evidence suggesting the profound influence of genetic factors in dental caries susceptibility. The present study aimed to evaluate the association between single nucleotide polymorphisms (SNPs) in ENAM (rs12640848), MMP20 (rs1784418), TAS2R38 (rs713598), and LTF (rs4547741) genes and early childhood caries (ECC) in Saudi preschool children. This case-control study enrolled 360 Saudi preschool children (262 with ECC and 98 caries-free). Data on environmental factors were collected through a questionnaire. However, caries experience and oral hygiene data were obtained during clinical examination. Buccal swab samples were collected for DNA extraction and SNPs were genotyped using PCR and DNA sequencing. Children with ECC were compared to caries free children (control), then they were categorized into two categories based on ECC severity as follows; non-severe ECC (NS-ECC), and severe-ECC (S-ECC). Association between the SNPs, ECC, NS-ECC, and S-ECC was reported as an odds ratio (OR) with a 95% confidence interval (CI). The majority of the children (72.8%) exhibited ECC (31.7% NS-ECC and 41.1% S-ECC) with mean dmft of 4.20 ± 4.05. Multivariate analyses of environmental factors showed that nocturnal feeding was a risk factor for ECC (P = 0.008). Poor oral hygiene was also a risk factor for both NS-ECC and S-ECC (ECC: P < 0.0001, NS-ECC: P = 0.032 and S-ECC: P < 0.0001). Univariate analysis showed that the AG genotype of rs1784418 of MMP20 gene was protective against ECC (OR = 0.532; 95% CI = 0.316–0.897, P = 0.018) and against NS-ECC (OR = 0.436; 95% CI = 0.238–0.798, P = 0.007). When environmental risk factors for ECC were included as covariates during multivariate analysis, AG variant in rs1784418 of MMP20 gene remained less frequent in NS-ECC cases compared to controls with borderline significance (OR = 0.542; 95% CI = 0.285–1.033, P = 0.063). Our findings concluded that MMP20 rs1784418 SNP might be associated with protection against ECC in Saudi preschool children.     

Extracellular biosynthesis,characterization, optimization of silver nanoparticles (AgNPs) using Bacillus mojavensis BTCB15 and its antimicrobial activity against multidrug resistant pathogens

Abstract

Biosynthesis of metal nanoparticles is an area of interest among researchers because of its eco-friendly approach. Current study focuses at biosynthesis of silver nanoparticles (AgNPs) and optimization of physico-chemical conditions to obtain mono-dispersed and stable AgNPs having antimicrobial activity. Initially Bacillus mojavensis BTCB15 produced silver nanoparticles (AgNPs) of 105?nm. Silver nanoparticles (AgNPs) were characterized by particle size analyzer, UV-Vis Spectroscopy, Fourier transforms infrared spectroscopy (FTIR), Atomic force microscopy (AFM), and X-ray diffraction (XRD). Whereas, under optimal conditions of temperature 55?°C, pH 8, addition of surfactant Tween 20, and metal ion K₂SO₄, about 104% size reduction was achieved with average size of 2.3nm. Molecular characterization revealed 98% sequence homology with Bacillus mojavensis. AgNPs exhibited antibacterial activity at concentrations ranging from 0.5 to 2.5?µg/µl against Escherichia coli BTCB03, Klebsiella pneumonia BTCB04, Acinetobacter sp. BTCB05, and Pseudomonas aeruginosa BTCB01 but none against Staphylococcus aureus BTCB02. Highest antibacterial activity was observed at 0.27?µg/µl and lowest at 0.05?µg/µl of AgNPs indicated by zone of inhibition. Conclusively, under optimum conditions, Bacillus mojavensis BTCB15 was able to produce AgNPs of 2.3?nm size and had antibacterial activity against multi drug resistant pathogens.