Site of clomazone action in tolerant-soybean and susceptible-cotton photomixotrophic cell suspension cultures

Studies were conducted to determine the herbicidal site of clomazone action in tolerant-soybean (Glycine max [L.] Merr. cv Corsoy) (SB-M) and susceptible-cotton (Gossypium hirsutum [L.] cv Stoneville 825) (COT-M) photomixotrophic cell suspension cultures. Although a 10 micromolar clomazone treatment did not significantly reduce the terpene or mixed terpenoid content (microgram per gram fresh weight) of the SB-M cell line, there was over a 70% reduction in the chlorophyll (Chl), carotenoid (CAR), and plastoquinone (PQ) content of the COT-M cell line. The tocopherol (TOC) content was reduced only 35.6%. Reductions in the levels of Chl, CAR, TOC, and PQ indicate that the site of clomazone action in COT-M cells is prior to geranylgeranyl pyrophosphate (GGPP). The clomazone treatment did not significantly reduce the flow of [¹⁴C]mevalonate ([¹⁴C]MEV) (nanocuries per gram fresh weight) into CAR and the three mixed terpenoid compounds of SB-M cells. Conversely, [¹⁴C]MEV incorporation into CAR and the terpene moieties of Chl, PQ, and TOC in COT-M cells was reduced at least 73%, indicating that the site of clomazone action must be after MEV. Sequestration of clomazone away from the chloroplast cannot account for soybean tolerance to clomazone since chloroplasts isolated from both cell lines incubated with [¹⁴C]clomazone contained a similar amount of radioactivity (disintegrations per minute per microgram of Chl). The possible site(s) of clomazone inhibition include mevalonate kinase, phosphomevalonate kinase, pyrophosphomevalonate decarboxylase, isopentenyl pyrophosphate isomerase, and/or a prenyl transferase.     

Purification and properties of recombinant β-glucosidase of the hyperthermophilic bacterium Thermotoga maritima

A -glucosidase of the hyperthermophilic bacterium Thermotoga maritima has been purified from a recombinant Escherichia coli clone expressing the corresponding gene. The enzyme was found to be a dimer with an apparent molecular mass of approximately 95 kDa as determined by size exclusion chromatography. It was composed of two apparently identical subunits of about 47 kDa (determined by sodium dodecyl sulphate-polyacrylamide gel electrophoresis). The enzyme had a bbroadsubstrate specificity and attacked -glucoside, -galactoside, -fucoside, and, to a very small extent, also -xyloside substrates. -Glycosidic bonds were not hydrolysed. Kinetic measurement of the hydrolysis of o-nitrophenyl--d-glucopyranoside (oNPGlc) and o-nitrophenyl--d-galactopyranoside (oNPGal) in the concentration ranges 0.05–20 mm and 0.1–10 mm, respectively, at 75°C resulted in non-linear Lineweaver-Burk and Eadie-Hofstee 3lots whereas cellobiose and lactose did not induce this type of effect. Lactose caused substrate inhibition above 350 mm. The enzyme was optimally active at about pH 6.1. The T. maritima -glucosidase represents the most thermostable -glucosidase described to date. In 50 mm sodium phosphate buffer, pH 6.2, at an enzyme concentration of 50 g/ml, the pure enzyme without additives retained more than 60% of its initial activity after a 6-h incubation at 95°C. Correspondence to: W. Liebl     

mtDNA diversity in rhesus monkeys reveals overestimates of divergence time and paraphyly with neighboring species

Reconstructions of the human-African great ape phylogeny by using mitochondrial DNA (mtDNA) have been subject to considerable debate. One confounding factor may be the lack of data on intraspecific variation. To test this hypothesis, we examined the effect of intraspecific mtDNA diversity on the phylogenetic reconstruction of another Plio- Pleistocene radiation of higher primates, the fascicularis group of macaque (Macaca) monkey species. Fifteen endonucleases were used to identify 10 haplotypes of 40-47 restriction sites in M. mulatta, which were compared with similar data for the other members of this species group. Interpopulational, intraspecific mtDNA diversity was large (0.5%- 4.5%), and estimates of divergence time and branching order incorporating this variation were substantially different from those based on single representatives of each species. We conclude that intraspecific mtDNA diversity is substantial in at least some primate species. Consequently, without prior information on the extent of genetic diversity within a particular species, intraspecific variation must be assessed and accounted for when reconstructing primate phylogenies. Further, we question the reliability of hominoid mtDNA phylogenies, based as they are on one or a few representatives of each species, in an already depauperate superfamily of primates.      

(Beta alpha)8-barrel proteins of tryptophan biosynthesis in the hyperthermophile Thermotoga maritima.

To better understand the evolution of a key metabolic pathway, we have sequenced the trpCFBA gene cluster of the hyperthermophilic bacterium Thermotoga maritima. The genes were cloned by complementation in vivo of trp deletion strains of Escherichia coli. The new sequences, together with earlier findings, establish that the trp operon of T.maritima has the order trpE(G.D)CFBA, which might represent the ancestral organization of the tryptophan operon. Heterologous expression of the trp(G.D) and trpC genes in E.coli and N-terminal sequencing of their polypeptide products showed that their translation is initiated at the rate start codons TTG and ATC, respectively. Consequently, the N-terminus of the trp(G.D) fusion protein is 43 residues shorter than previously postulated. Amino acid composition and sequence analyses of the protein products of T.maritima trpC (indoleglycerol phosphate synthase), trpF (phosphoribosyl anthranilate isomerase) and trpA (alpha-subunit of tryptophan synthase) suggest that these thermostable (beta alpha)8-barrel proteins may be stabilized by additional salt bridges, compared with the mesostable forms. Another notable feature is the predicted lack of the N-terminal helix alpha 0 in the alpha-subunit of tryptophan synthase.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Variation in the ribosomal internal transcribed spacers and 5.8S rDNA among five species of Acropora (Cnidaria; Scleractinia): patterns of variation consistent with reticulate evolution

The ITS sequences of Acropora spp. are the shortest so far identified in any metazoan and are among the shortest seen in eukaryotes; ITS1 was 70-80 bases, and ITS2 was 100-112 bases. The ITS sequences were also highly variable, but base composition and secondary structure prediction indicate that divergent sequence variants are unlikely to be pseudogenes. The pattern of variation was unusual in several other respects: (1) two distinct ITS2 types were detected in both A. hyacinthus and A. cytherea, species known to hybridize in vitro with high success rates, and a putative intermediate ITS2 form was also detected in A. cytherea; (2) A. valida was found to contain highly (29%) diverged ITS1 variants; and (3) A. longicyathus contained two distinct 5.8S rDNA types. These data are consistent with a reticulate evolutionary history for the genus Acropora.      

Identification of residues important for NAD+ binding by the Thermotoga maritima alpha-glucosidase AglA,a member of glycoside hydrolase family 4

The NAD+-requiring enzymes of glycoside hydrolase family 4 (GHF4) contain a region with a conserved Gly-XXX-Gly-Ser (GXGS) motif near their N-termini that is reminiscent of the fingerprint region of the Rossmann fold, a conserved structural motif of classical nicotinamide nucleotide-binding proteins. The function of this putative NAD+-binding motif in the alpha-glucosidase AglA of Thermotoga maritima was probed by directed mutagenesis. The K(d) for NAD+ of the AglA mutants G10A, G12A and S13A was increased by about 300-, 5-, and 9-fold, respectively, while their K(m) for p-nitrophenyl-alpha-glucopyranoside was not seriously affected. The results indicate that the GXGS motif is indeed important for NAD+ binding by the glycosidases of GHF4.     

Identification of a novel cellulose-binding domain the multidomain 120 kDa xylanase XynA of the hyperthermophilic bacterium Thermotoga maritima

A segment of Thermotoga maritima strain MSB8 chromosomal DNA was isolated which encodes an endo-1,4-β-D-xylanase, and the nucleotide sequence of the xylanase gene, designated xynA, was determined. With a half-life of about 40 min at 90°C at the optimal pH of 6.2, purified recombinant XynA is one of the most thermostable xylanases known. XynA is a 1059-amino-acid (?120 kDa) modular enzyme composed of an N-terminal signal peptide and five domains, in the order A1-A2-B-C1-C2. By comparison with other xylanases of family 10 of glycosyl hydrolases, the central ?340-amino-acid part (domain B) of XynA represents the catalytic domain. The N terminal ?150-amino-acid repeated domains (A1-A2) have no significant similarity to the C-terminal ?170-amino-acid repeated domains (C1-C2). Cellulose-binding studies with truncated XynA derivatives and hybrid proteins indicated that the C-terminal repeated domains mediate the binding of XynA to microcrystalline cellulose and that C2 alone can also promote cellulose binding. C1 and C2 did not share amino acid sequence similarity with any other known cellulose-binding domain (CBD) and thus are CBDS of a novel type. Structurally related protein segments which are probably also CBDs were found in other multi-domain xylanolytic enzymes. Deletion of the N-terminal repeated domains or of all the non-catalytic domains resulted In substantially reduced tbermostability while a truncated xylanase derivative lacking the C-terminal tandem repeat was as thermostable as the full-length enzyme. It is argued that the multidomain organization of some enzymes may be one of the strategies adopted by thermophiles to protect their proteins against thermal denaturation.     

Proof-of-concept human laboratory study for protracted abstinence in alcohol dependence: effects of gabapentin

There is a need for safe medications that can effectively support recovery by treating symptoms of protracted abstinence that may precipitate relapse in alcoholics, e.g. craving and disturbances in sleep and mood. This proof-of-concept study reports on the effectiveness of gabapentin 1200 mg for attenuating these symptoms in a non-treatment-seeking sample of cue-reactive, alcohol-dependent individuals. Subjects were 33 paid volunteers with current Diagnostic and Statistical Manual of Mental Disorders-IV alcohol dependence and a strength of craving rating 1 SD or greater for alcohol than water cues. Subjects were randomly assigned to gabapentin or placebo for 1 week and then participated in a within-subjects trial where each was exposed to standardized sets of pleasant, neutral and unpleasant visual stimuli followed by alcohol or water cues. Gabapentin was associated with significantly greater reductions than placebo on several measures of subjective craving for alcohol as well as for affectively evoked craving. Gabapentin was also associated with significant improvement on several measures of sleep quality. Side effects were minimal, and gabapentin effects were not found to resemble any major classes of abused drugs. Results suggest that gabapentin may be effective for treating the protracted abstinence phase in alcohol dependence and that a randomized clinical trial would be an appropriate next step. The study also suggests the value of cue-reactivity studies as proof-of-concept screens for potential antirelapse drugs.