The p53 isoforms are differentially modified by Mdm2

The discovery that the single p53 gene encodes several different p53 protein isoforms has initiated a flurry of research into the function and regulation of these novel p53 proteins. Full-length p53 protein level is primarily regulated by the E3-ligase Mdm2, which promotes p53 ubiquitination and degradation. Here, we report that all of the novel p53 isoforms are ubiquitinated and degraded to varying degrees in an Mdm2-dependent and -independent manner, and that high-risk human papillomavirus can degrade some but not all of the novel isoforms, demonstrating that full-length p53 and the p53 isoforms are differentially regulated. In addition, we provide the first evidence that Mdm2 promotes the NEDDylation of p53β. Altogether, our data indicates that Mdm2 can distinguish between the p53 isoforms and modify them differently.     

The analysis of recombinant interleukin-2 by thermospray liquid chromatography-mass spectrometry

The complete sequence of recombinant human interleukin-2 expressed in Escherichia coli has been confirmed by thermospray liquid chromatography-mass spectrometry (TS-LC-MS) of a tryptic digest derived from 100 micrograms (7 nmol) of reduced carboxymethylated interleukin-2. The preparation was shown by this method to contain predominantly unprocessed N-terminal initiator Met, with some authentic N-terminal Ala; the rest of the protein was as predicted from the DNA sequence, though some deamidated material was noted. TS-LC-MS proved to be a rapid and efficient method for surveying the protein tryptic peptide products allowing all the data to be collected in one chromatographic run; all tryptic fragments were identified by their molecular ions including those for the larger peptides (Mr 1500-3500) which, due to the presence of doubly and triply charged molecular ions, were brought within the mass range of the instrument (1800 Da). It is proposed that TS-LC-MS is a good general method for analyzing recombinant protein digests with respect to sequence confirmation, processing, and post-translational modification, and since each chromatographic peak is identified allows for subsequent monitoring of the protein by LC using uv detection. The method suffers from the disadvantages that all the sample is consumed during the experiment and that no fragment (sequence) ions are generally observed.     

The effect of age on enolase turnover in the free-living nematode, Turbatrix aceti.

The rates of synthesis and degradation of enolase and total soluble proteins slow with age in the free-living nematode, Turbatrix aceti. The half-lives are 73 and 58 h for soluble protein and enolase, respectively, in young organisms (5 days old). The respective figures are 163 and 161 h for old organisms (22–30 days old). Similar slowing of protein turnover occurs when the organisms are aged by a repeated screening procedure which avoids the use of fluorodeoxyuridine, an inhibitor of DNA synthesis normally added to aging cultures to obtain synchrony. The results support the idea that slowed protein turnover may be responsible for the formation of altered enzymes in old organisms.     

Contraction of filaments of Escherichia coli after disruption of cell membrane by detergent.

The osmotic pressure within a living bacterium creates stresses in the peptidoglycan that stretch the sacculus. We measured the amount of stretch by monitoring the shrinkage of growing cells of Escherichia coli after removal of the osmotic pressure by disruption of the phospholipid membranes with sodium dodecyl sulfate. Because the rods of the wild type are so short, length changes of filaments of longer than 7 microns were measured on phase-contrast micrographs. The filaments were prepared by growing ftsA and ftsI strains under permissive conditions in rich medium and then shifting them to 42 degrees C for 40 to 180 min. During this time, the mutant cells became elongated but did not divide. The growing filaments were mounted on a glass surface that had been treated with poly-L-lysine or RNase. The filaments were photographed before being treated with sodium dodecyl sulfate. The filaments were rephotographed at the time when the first change in phase contrast was noted. Some filaments were also measured at 10-min time intervals from 0 to 60 min. The reduction in phase contrast signaled the leakage of solutes and the loss of turgor pressure. The average length of the filaments decreased 17%. If the circumference were stretched to the same degree, then the surface area in vivo would be 45% greater than in the relaxed state. For comparison, a fully cross-linked monolayer of E. coli peptidoglycan in its most compact conformation could stretch up to 300% in achieving the most extended conformation possible without splitting covalent bonds.     

Spasmodic, a mutation on chromosome 11 in the mouse

A new recessive mutation, spasmodic (spd), producing behavior that mimics that of the neurological mutation spastic (spa) with rapid tremors, stiff posture, and difficulty in righting, arose spontaneously in strain A/HeJ at the Jackson Laboratory in 1979. It is not an allele of spa and linkage tests show that this mutation is located close to vestigial tail (vt) near the center of chromosome 11. Additional genetic tests show that it is not an allele of trembler (Tr), shaker-2 (sh-2), nor vibrator (vb), all neurological mutations located in the same region of chromosome 11. No differences were observed in the levels of the major CNS and PNS myelin proteins or lipids of spd/spd mice versus littermate controls, suggesting that, unlike several closely linked mutations, the spd mutation does not affect myelination. Pharmacological studies reported here show that aminooxyacetic acid improves the behavioral abnormalities of affected spd/spd mice in the same way it improves the behavior of affected spa/spa mice. However, unlike the spa/spa mice, there are no changes in the postsynaptic receptors for glycine, GABA, or benzodiazepines in spd/spd mice.     

The adenovirus Ela gene induces differentiation of F9 teratocarcinoma cells.

Undifferentiated F9 cells transfected with plasmids encoding adenovirus E1a gene products underwent radical morphological changes. They ceased to express the SSEA-1 stem cell marker antigen and started to express a number of the characteristics of the differentiated state that is induced in F9 cells by treatment with retinoic acid. In particular, they expressed keratin intermediate filaments and acquired the ability to synthesise simian virus 40 tumor antigens after virus infection. The transfected cells expressed the E1a proteins, and this expression was necessary to induce the phenotypic changes, since a coisogenic plasmid encoding only a truncated 70-amino-acid E1a polypeptide and the transfection procedure itself did not detectably after the morphology or marker expression of the F9 stem cells. The phenotypic change was induced by both 13S and 12S cDNA plasmids. We discuss these results in the context of known E1a functions and with reference to the other oncogenes and external factors that can cause F9 cell differentiation.     

Anti-thrombin activities of heparin. Effect of saccharide chain length on thrombin inhibition by heparin cofactor II and by antithrombin.

The interactions of two proteinase inhibitors, heparin cofactor II and antithrombin, with thrombin are potentiated by heparin. Using two methods, we have studied the potentiating effects of a series of heparin (poly)saccharides with high affinity for antithrombin and mean Mr ranging from approx. 1700 to 18,800. First, catalytic amounts of heparin (poly)saccharide were added to purified systems containing thrombin and either heparin cofactor II or antithrombin. Residual thrombin activity was determined with a chromogenic substrate. It was found that only the higher-Mr polysaccharides (Mr greater than 8000) efficiently catalysed thrombin inhibition by heparin cofactor II, there being a progressive catalytic effect with increasing Mr of the polysaccharide. Weak accelerating effects were noted with low-Mr saccharides (Mr less than 8000). This contrasted with the well-characterized interaction of heparin with antithrombin and thrombin, where heparin oligosaccharides of Mr less than 5400 had absolutely no ability to accelerate the reaction, while (poly)saccharides of Mr exceeding 5400 showed rapidly increasing catalytic activity with increasing Mr. Secondly, these and other heparin preparations were added in a wide concentration range to plasma with which 125I-labelled thrombin was then incubated for 30 s. Inhibited thrombin was determined from the distribution of labelled thrombin amongst inhibitor-thrombin complexes, predominantly antithrombin-thrombin and heparin cofactor II-thrombin complexes. In this situation, where the inhibitors competed for thrombin and for the (poly)saccharides, it was found that, provided the latter were of high affinity for antithrombin and exceeded a Mr of 5400, thrombin inhibition in plasma was mediated largely through antithrombin. Polysaccharides of Mr exceeding 8000 that were of low affinity for antithrombin accelerated thrombin inhibition in plasma through their interaction with heparin cofactor II. High concentrations of saccharides of Mr 1700-5400 exhibited a size-dependent acceleration of thrombin inhibition, not through their interaction with antithrombin, but through their interaction with heparin cofactor II.     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.