Seasonal variation in food allergy to apple

The aim of the study was to investigate the possibility of a seasonal variation in reactivity to apples in 27 birch pollen allergic patients. Before and during the birch pollen season 1998, the patients were subjected to double-blind, placebo-controlled food challenges (DBPCFCs) with grated fresh Golden Delicious apple followed by an open food challenge with whole fresh apple. The clinical reactions elicited during the challenges were evaluated both by the patients and the investigators. Moreover, the skin reactivity and the in vitro reactivity to apple were evaluated by skin prick test (SPT), leukocyte histamine release (HR), measurement of specific IgE, and immunoblotting experiments. The sensitivity of the DBPCFC, when compared with the result of the open challenge, was 0.74 (14/19) before the season and 0.80 (16/20) during the season. None of the patients reacted to the blinded challenge without a subsequent reaction to the open challenge. One placebo reaction was registered both before and in season, but not in the same patient. The patient scores of the first positive challenges, and the maximal scores of each combined blinded and open challenge session, were significantly increased during the pollen season (P<0.05). The scores of the open challenge were significantly higher than the scores of the DBPCFC both before the season and during the in-season challenges (P<0.05). Specific IgE against Golden Delicious increased during season (P<0.05), while neither SPT, HR, nor immunoblotting experiments could confirm an increase in reactivity. In conclusion, the results of the oral challenge tests indicated an increase in clinical reactivity to apples during the birch pollen season in birch pollen allergic individuals.     

A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Cellular regulation of ADP-ribosylation of proteins. III. Selective augmentation of in vitro ADP-ribosylation of histone H3 in murine thymic cells after in vivo emetine treatment

Thymic cells were isolated at intervals of between 0 and 144 h from mice that received one intraperitoneal injection of emetine (33 mg/kg), and thymus weight, incorporation of [14C]leucine into proteins and [3H]thymidine into DNA in intact thymic cells, as well as initial rates of protein ADP-ribosylation in permeabilized cells [A. Sóoki-Tóth, F. Asghari, E. Kirsten, and E. Kun (1987) Exp. Cell Res. 170, 93] were simultaneously monitored. The effect of emetine as an inhibitor of protein synthesis [F. Antoni, N. G. Luat, I. Csuka, I. Oláh, A. Sóoki-Tóth, and G. Bánfalvi (1987) Int. J. Immunopharmacol. 9, 333] corresponds to the induction of sequential cellular events, such as cell exit and remigration, by other antimitotic agents [C. Penit and F. Vasseur (1988) J. Immunol. 140, 3315] and produces an activation of proliferation of cells reentering into this organ. Proliferation, as demonstrated by a large increase in DNA synthesis and entrance into S phase, was kinetically related to an apparent increase in poly(ADP-ribose) polymerase activity in thymic cells and a highly significant in vitro ADP-ribosylation of histone H3. Since no DNA fragmentation occurred in thymic cells, as tested by a fluorometric technique [C. Birnboim and J. J. Jevac (1981) Cancer Res. 41, 1889], it is probable that a selective activation of poly(ADP-ribose) polymerase may have been induced in cells that undergo differentiation and proliferation while repopulating the thymus.     

Nanoplanktonic coccolithophorids (Prymnesiophyceae, Haptophyceae) from the Weddell Sea, Antarctica

The examination of whole mounts prepared for transmission electron microscopy has resulted in the finding of thirteen taxa of nanoplanktonic coccolithophorids from the Weddell Sea, Antarctica. The material was collected as part of the AMERIEZ programme, March 1986. Cold-water adapted nanoplanktonic coccolithophorids have previously been shown to constitute a recurrent plankton element at subarctic and arctic localities. Three of the Weddell Sea species, Wigwamma annulifera, W. arctica , and Papposphaera sagittifera , are conspecific with northern hemisphere material, while two species, Calciarcus alaskensis and Turrisphaera arctica , are possibly identical with previously described arctidsubarctic material. Six taxa new to science have been described from the Weddell Sea, Wigwamma antarctica, W. triradiata, Trigonaspis melvillea, Pappomonas weddellensis, Papposphaera obpyramidalis , and P. simplicissima . The cooccurrence of identical forms at the two poles, and the fact that the species described are allocated to "arctic" genera, indicate a geologically relatively recent exchange of biological material between the poles.     

Mechanisms of lymphocytic choriomeningitis virus-induced hemopoietic dysfunction.

Results of this study showed that lymphocytic choriomeningitis virus infection causes a marked activation of natural killer (NK) cells not only in the spleen but also in the bone marrow. This activity reached its peak at about day 3 of infection and declined after days 6 to 7. Enhanced NK cell activity was found to correlate with decreased receptivity for syngeneic stem cells in bone marrow and spleen, with the notable exception that decreased receptivity persisted longer in bone marrow. Treatment of infected recipients with anti-asialo GM1 (ganglio-N-tetraosylceramide) significantly increased the receptivity for syngeneic hemopoietic cells. These findings are consistent with the hypothesis that NK cell activation causes rejection of syngeneic stem cells, thus resulting in hemopoietic depression. To understand the mechanisms behind the prolonged decrease in bone marrow receptivity (and bone marrow function in the intact mouse) mentioned above, we followed the changes in the number of pluripotential stem cells (CFU-S) circulating in the peripheral blood and in endogenous spleen colonies in irradiated mice, the limbs of which were partially shielded. It was found that following a marked early decline, both parameters increased to normal or supranormal levels at about day 9 after infection. Because the bone marrow pool of CFU-S is only about 20% of normal at this time after infection, a marked tendency for CFU-S at this stage in the infection to migrate from the bone marrow to the spleen is suggested. It seems, therefore, that as NK cell activity declines, the spleen regains the ability to support growth of hemopoietic cells and the bone marrow resumes an elevated export of stem cells to the spleen. This diversion of hemopoiesis could explain both the long-standing deficiencies of the bone marrow compartment and the prolonged decrease in the receptivity of this organ.     

Mitogen Stimulation of Lymphocytes in Pigs with Hereditary Vitamin C Deficiency

Recently an inherited vitamin G deficiency in the pigs presumably based on an autosomal recessive gene was decribed* Homozygotes are in contrast to heterozygotes and normal pigs unable to synthesize ascorbic acid. In an experiment comprising 3 littermate pigs, 2 homozygous and 1 heterozygous for the vitamin C deficiency gene, the influence of ascorbic acid depletion, and repletion on mitogen stimulation of peripheral blood lymphocytes was studied. Ascorbic acid depletion of the vitamin C dependent pigs resulted in a rapid decline in plasma ascorbic acid. Response of lymphocytes to stimular tion with Concanavalin A (Con A) and phytohemagglutinin M (PHA) decreased more slowly reaching a minimum, which coincidedi with the occurrence of the first clinical symptoms of scurvy. Following resupplementation with vitamin C the plasma content of ascorbic acid rapidly returned to normal, while the lymphocyte response to Con A and PHA stimulation only gradually approached the initial values. The repletion with ascorbic acid caused a transitory increase in the response to pokeweed mitogen (PWM) stimulation. The significance of these findings in relation to the cellular immune system in normal pigs is discussed.