Seasonal variation in food allergy to apple

The aim of the study was to investigate the possibility of a seasonal variation in reactivity to apples in 27 birch pollen allergic patients. Before and during the birch pollen season 1998, the patients were subjected to double-blind, placebo-controlled food challenges (DBPCFCs) with grated fresh Golden Delicious apple followed by an open food challenge with whole fresh apple. The clinical reactions elicited during the challenges were evaluated both by the patients and the investigators. Moreover, the skin reactivity and the in vitro reactivity to apple were evaluated by skin prick test (SPT), leukocyte histamine release (HR), measurement of specific IgE, and immunoblotting experiments. The sensitivity of the DBPCFC, when compared with the result of the open challenge, was 0.74 (14/19) before the season and 0.80 (16/20) during the season. None of the patients reacted to the blinded challenge without a subsequent reaction to the open challenge. One placebo reaction was registered both before and in season, but not in the same patient. The patient scores of the first positive challenges, and the maximal scores of each combined blinded and open challenge session, were significantly increased during the pollen season (P<0.05). The scores of the open challenge were significantly higher than the scores of the DBPCFC both before the season and during the in-season challenges (P<0.05). Specific IgE against Golden Delicious increased during season (P<0.05), while neither SPT, HR, nor immunoblotting experiments could confirm an increase in reactivity. In conclusion, the results of the oral challenge tests indicated an increase in clinical reactivity to apples during the birch pollen season in birch pollen allergic individuals.     

α-MSH Stimulates Glucose Uptake in Mouse Muscle and Phosphorylates Rab-GTPase-Activating Protein TBC1D1 Independently of AMPK

The melanocortin system includes five G-protein coupled receptors (family A) defined as MC1R-MC5R, which are stimulated by endogenous agonists derived from proopiomelanocortin (POMC). The melanocortin system has been intensely studied for its central actions in body weight and energy expenditure regulation, which are mainly mediated by MC4R. The pituitary gland is the source of various POMC-derived hormones released to the circulation, which raises the possibility that there may be actions of the melanocortins on peripheral energy homeostasis. In this study, we examined the molecular signaling pathway involved in α-MSH-stimulated glucose uptake in differentiated L6 myotubes and mouse muscle explants. In order to examine the involvement of AMPK, we investigate α-MSH stimulation in both wild type and AMPK deficient mice. We found that α-MSH significantly induces phosphorylation of TBC1 domain (TBC1D) family member 1 (S237 and T596), which is independent of upstream PKA and AMPK. We find no evidence to support that α-MSH-stimulated glucose uptake involves TBC1D4 phosphorylation (T642 and S704) or GLUT4 translocation.     

A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Formation and activity of covalent conjugates of poliovirus and ligands binding to cell surface structures

Disulfide-linked conjugates of poliovirus with streptavidin or concanavalin A were formed and the binding of the conjugates to mouse L cells that lack natural poliovirus receptors was studied. The conjugate with streptavidin was specifically bound to biotinylated L cells, but not to unmodified L cells. The conjugate with conA was bound to L cells in the absence of, but not in the presence of alpha-methyl mannoside. Incubation of L cells with bound conjugates did not produce virus, although the conjugates were highly infectious in HeLa cells, containing natural poliovirus receptors. This suggests that the artificially bound virus was unable to penetrate the L cells and start replication. The possibility that binding of the virus to the natural receptor is required for efficient infection is discussed.     

Bicarbonate/chloride antiport in Vero cells: I. Evidence for both sodium-linked and sodium-independent exchange

The effect of bicarbonate on the ability of cells to regulate the internal pH after acid and alkali loads was studied. In the presence of Na+, the normalization of the internal pH after acid loads occurred more rapidly in the presence than in the absence of bicarbonate. DIDS (4,4'-diisothiocyano-2,2'-stilbene-disulfonic acid) strongly inhibited the pH increase, whereas amiloride inhibited it to a lesser extent. The Na+-linked, bicarbonate-dependent pHi increase after an acid load was strongly reduced in cells depleted of Cl-. When cells were transferred to gluconate or mannitol balanced buffers containing bicarbonate, there was a rapid alkalinization of the cytosol, apparently due to influx of bicarbonate induced by chloride efflux. When the internal pH was below 7.0, the pH increase was much more rapid in the presence than in the absence of Na+, whereas at higher internal pH, there was no measurable effect of Na+. The ability of the cells to reduce the internal pH after an alkali load was increased in the presence of bicarbonate. The data indicate that both Na+-linked and Na+-independent bicarbonate/chloride exchange occur in Vero cells.