Effect of pinocembrin isolated from Alpinia zerumbet on osteoblast differentiation

Cytotechnology - Bone mass is regulated by osteoblast-mediated bone formation and osteoclast-mediated bone resorption. Osteoporosis is a bone metabolism disorder in which bone mass decreases due to...     

Seasonal Dynamics of Dimethylarsenic Acid Degrading Bacteria Dominated in Lake Kibagata

Degradation processes of organoarsenic compounds significantly influence arsenic cycles in aquatic environments and would depend on the bacterial activities. The bacterial population involving dimethylarsinic acid (DMAA) degradation was investigated in Lake Kibagata from April to December in 2003. During the experimental period, the methylated arsenic was not detected, although the inorganic arsenic concentration ranged from 3.4 nM to 9.2 nM. Moreover, in the sample water of Lake Kibagata to which DMAA added, DMAA decreased while inorganic arsenic increased for 25 days. These facts suggested that the bacteria remineralized methylate arsenic species to inorganic arsenic. In fact, monitoring the use of Most Probable Number (MPN) procedure demonstrated that the DMAA-degrading bacteria exist at cell densities ranged from 41 cells/ml to 510 cells/ml. To determine the composition of DMAA-degrading bacteria, the total 110 isolates obtained as dominated bacterial species were analyzed by the restriction-fragment-length polymorphism (RFLP) analysis of 16S rDNA. As a result, total 110 isolates were classified into 12 types, of which 4 types dominated during the spring and/or fall seasons, and the rest 8 types dominated during summer season. DMAA degrading activities of the 110 isolates ranged at various degrees. Especially, the some isolates of fall season tend to show high degradation activities. The phylogenetic analysis using 16S rDNA revealed that the representative isolates formed several clusters in the gram-positive bacterial group and the proteobacteria subdivision. The diverse compositions of DMAA-degrading bacteria would seasonally change to control the rates of organoarsenic degradation in Kibagata.     

Synthesis of Isoprenyl Chalcone “Sophoradin”

Nicotine has been found an effective photosensitizer for DDT. At DDT: nicotine (1:5), DDT along with its formed degradation products DDD, DDE and DBP disappeared within 18 and 60 days under UV and sunlight respectively. Because of persistence, nicotine proved a superior photosensitizer to N,N′-diethylaniline. In DDT emulsifiable concentrates it led to high alkalinity but no DDT degradation up to 60 days at 20~25°C. 0.1 and 0.5% DDT emulsions from these formulations showed no adverse effect on Daucus carrota, Vicia faba, Brassica oleracea var. botrytis, and Dahlia sp., but showed mild to severe phytotoxicity against Pisum sativum and Cicer arietinum; caused by high concentration of nicotine. On Clerodendrum sp. in sunlight, these formulations showed over 20% faster DDT loss between 3~15 days of application. DDT-nicotine mixtures showed no synergism against Tribolium castaneum Herbst.     

Binding of Polysaccharide to Peptidoglycan in Cell Wall of Streptomyces roseochromogenes

The polysaccharide-peptidoglycan complex, which was prepared with lysozyme from Streptomyces roseochromogenes IAM53 cell walls, was hydrolyzed with lytic enzyme of Flavo-bacterium to separate polysaccharide. The enzymatically prepared polysaccharide (100 mg) contained 500 μmoles of hexoses, 40 μmoles of hexosamines and 31 μmoles of phosphate. Hexoses consisted of mannose and galactose in a molar ratio of 5 to 1. Hexosamines consisted of equimolar glucosamine and muramic acid, a half of which was identified as muramic acid 6-phosphate. The reducing end of the polysaccharide was muramic acid. The polysaccharide extracted with trichloroacetic acid contained no muramic acid-phosphate. So the polysaccharide moiety of S. roseochromogenes cell walls must be linked covalently to 6-position of muramic acid in peptidoglycan through phosphate,     

Inhibition of osteoporosis due to restricted food intake by the fish oils DHA and EPA and perilla oil in the rat

Seven-week old female rats fed restricted foods including the fish oils Docosahesaenoic Acid (DHA) and Eicosapentaenoic Acid (EPA) and perilla oil with food intake decreased by 50%, had increases of fracture force and bone mineral density (BMD) and decreases in levels of Deoxypiridinoline (Dpd) and Calcium (Ca) in the urine, compared with those of rats with osteoporosis due to restricted soy bean oil food intake. Therefore, the fish oils DHA and EPA and perilla oil depressed excretion of urinary Ca and inhibited osteoporosis due to restricted food intake.     

NikAB- or NikB-dependent intracellular recombination between tandemly repeated oriT sequences of plasmid R64 in plasmid or single-stranded phage vectors

The origin of transfer (oriT) of a bacterial plasmid plays a key role in both the initiation and termination of conjugative DNA transfer. We have previously shown that a conjugation-dependent recombination between the tandem R64 oriT sequences cloned into pHSG398 occurred, resulting in the deletion of the intervening sequence during DNA transfer. In this study, we tandemly cloned two oriT sequences of IncI1 plasmid R64 into pUC18. Specific recombination between the two oriT sequences in pUC18 was observed within Escherichia coli cells harboring mini-R64. This recombination was found to be independent of both the recA gene and conjugative DNA transfer. The R64 genes nikA and nikB, required for conjugal DNA processing, were essential for this recombination. Although a fully active 92-bp oriT sequence was required at one site for the recombination, the 44-bp oriT core sequence was sufficient at the other site. Furthermore, when two oriT sequences were tandemly cloned into the single-stranded phage vector M13 and propagated within E. coli cells, recombination between the two oriT sequences was observed, depending on the nikB gene. These results suggest that the R64 relaxase protein NikB can execute cleavage and rejoining of single-stranded oriT DNA within E. coli cells, whereas such a reaction in double-stranded oriT DNA requires collaboration of the two relaxosome proteins, NikA and NikB.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Chromosomal and extrachromosomal synthesis of exfoliative toxin from Staphylococcus hyicus

Evidence for the existence of two molecular species of exfoliative toxin (ET) synthesized by Staphylococcus hyicus (SHET) under chromosomal and plasmid control is presented. Serological evidence that these molecular species of toxins are distinct from each other is given. The molecular weights of SHET from plasmidless strain P-1 (SHETA) and from plasmid-carrying strains P-10 and P-23 (SHETB) were almost equal. Both of the serotypes of SHET exhibited exfoliation in 1-day-old chickens. The plasmid-cured (P(-)) substrains (P-23C1 and P-23C2) of S. hyicus P-23 did not cause exfoliation in 1-day-old chickens, whereas P(-) substrains (P-10C1 and P-10C2) of strain P-10 caused exfoliation, but they decreased their exfoliative activity. These findings suggest that SHETB was synthesized along with SHETA by strain P-10, whereas the P-23 strain synthesized SHETB alone. The plasmid-carrying strain (P-23) as well as the plasmidless strain (P-1) exhibited the typical clinical signs of exudative epidermitis in pigs. However, plasmid-cured (P(-)) substrains of P-23 (P23C1 and P23C2) did not exhibit the typical clinical signs of exudative epidermitis. These findings suggest that SHETA is synthesized under chromosomal control and SHETB is synthesized under plasmid control and that SHET-producing strains can be divided into three groups: SHETA-producing strains, SHETB-producing strains, and strains producing both toxins.