Phylogeography of the cactophilic species Drosophila gouveai: demographic events and divergence timing in dry vegetation enclaves in eastern Brazil

Aim  The aim of this study was to assess the causal mechanisms underlying populational subdivision in Drosophila gouveai , a cactophilic species associated with xeric vegetation enclaves in eastern Brazil. A secondary aim was to investigate the genetic effects of Pleistocene climatic fluctuations on these environments.
Location  Dry vegetation enclaves within the limits of the Cerrado domain in eastern Brazil.
Methods  We determined the mitochondrial DNA haplotypes of 55 individuals (representing 12 populations) based on sequence data of a 483-bp fragment from the cytochrome c oxidase subunit II (COII) gene. Phylogenetic and coalescent analyses were used to test for the occurrence of demographic events and to infer the time of divergence amongst genetically independent groups.
Results  Our analyses revealed the existence of two divergent subclades (G1 and G2) plus an introgressed clade restricted to the southernmost range of D. gouveai . Subclades G1 and G2 displayed genetic footprints of range expansion and segregated geographical distributions in south-eastern and some central highland regions, east and west of the Paraná River valley. Molecular dating indicated that the main demographic and diversification events occurred in the late to middle Pleistocene.
Main conclusions  The phylogeographical and genetic patterns observed for D. gouveai in this study are consistent with changes in the distribution of dry vegetation in eastern Brazil. All of the estimates obtained by molecular dating indicate that range expansion and isolation pre-dated the Last Glacial Maximum, occurring during the late to middle Pleistocene, and were probably triggered by climatic changes during the Pleistocene. The current patchy geographical distribution and population subdivision in D. gouveai is apparently closely linked to these past events.     

Effect of transforming growth factor beta (TGF-β) on ATP citrate lyase in isolated hepatocytes

Summary Transforming growth factor beta (TGF-) activates ATP citrate lyase in freshly isolated rat liver hepatocytes in a time dependent manner. Maximal stimulation of the enzyme occurred with less than thirty minutes of incubation of the cells with TGF-. The half maximal effect on the enzyme determined in hepatocytes incubated with TGF- for 10 min at 37°C was elicited by TGF- concentrations in the 10^–11 – 10^–12 M range. The potential role of TGF- stimulation of ATP citrate lyase activity in new membrane synthesis is discussed.     

The unusual social organization of the antPachycondyla tridentata (Formicidae,ponerinae)

Colonies of the ponerine antPachycondyla tridentata from Malaysia occur with and without queens. In a total of 7 colonies we found more than 80% of the workers to be mated, irrespective of the presence or absence of queens. This is a hitherto unknown social organisation in ants. Queens and workers competed equally for reproduction. In the colonies investigated several ants were laying eggs. Behavioral observations revealed persistent dominance interactions between colony members. A few ants, but not necessarily a queen, occupied top positions. Removal of the most dominant ants led to a new hierarchy in which subordinate ants with developed ovaries were attacked significantly more frequently than non-reproductive ants. On the average, callows were more aggressive than older subordinate ants, displacing most of the older laying workers in one colony. Nestmate recognition tests revealed that non-reproductive ants were much more aggressive towards foreign ants than were ants with developed ovaries.     

Effects of tRNALeu1 overproduction in Escherichia coli

Strains of Escherichia coli have been produced which express very high levels of the tRNA^leu₁ isoacceptor. This was accomplished by transforming cells with plasmids containing the leuV operon which encodes three copies of the tRNA^Leu₁ gene. Most transformants grew very slowly and exhibited a 15-fold increase in cellular concentrations of tRNA^Leu₁ As a result, total cellular tRNA concentration was approximately doubled and 56% of the total was tRNA^Leu₁. We examined a number of parameters which might be expected to be affected by imbalances in tRNA concentration: in vivo tRNA charging levels, misreading, ribosome step time, and tRNA modification. Surprisingly, no increase in intracellular ppGpp levels was detected even though only about 40% of total leucyl tRNA was found to be charged in vivo. Gross ribosomal misreading was not detected, and it was shown that ribosomal step times were reduced between two- and threefold. Analyses of leucyl tRNA isolated from these slow-growing strains showed that at least 90% of the detectable tRNA^Leu₁ was hypomodified as judged by altered mobility on RPC-5 reverse-phase columns, and by specific modification assays using tRNA(m¹G)-methyltransferase and pseudo-uridylate synthetase. Analysis of fast-growing revertants demonstrated that tRNA concentration per se may not explain growth inhibition because selected revertants which grew at wild-type growth rates displayed levels of tRNA comparable to that of control strains bearing the leuV operon. A synthetic tRNA^Leu₁ operon under the control of the T7 promoter was prepared which, when induced, produced six- to sevenfold increases in tRNA^Leu₁ levels. This level of tRNA^Leu₁ titrated the modification system as judged by RPC-5 column chromatography. Overall, our results suggest that hypomodified tRNA may explain, in part, the observed effects on growth, and that the protein-synthesizing system can tolerate an enormous increase in the concentration of a single tRNA.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Territory size and distribution of newly-emerged Atlantic salmon (Salmo salar)

Newly emerged Atlantic salmon (Salmo salar) were observed from May to August 1981 at six isolated redds in Washington County, Maine, USA. Territorial size and distribution were measured. At the end of the emergence period (12 to 28 May), fish maintained positions (stations) at redds where water velocity did not exceed 52 cm s^–1 By 12 June, most salmon (80–96%) had moved off the redds of origin and had established territories 1 to 5 m from the redd. The area defended increased substantially after mid-June, but territorial aggression diminished by 15 July, and the fry dispersed downstream. All fish observed were territorial, and the percentage of time during which stations were held decreased from 89 in mid-May to as low as 40% in mid-June.Cooperators are the Maine Department of Inland Fisheries and Wildlife, University of Maine, U.S. Fish and Wildlife Service, and the Wildlife Management Institute     

Induction of tyrosine aminotransferase by pyridoxine in Drosophila hydei

Salivary glands incubated in various concentrations of pyridoxine (Vitamin B₆) show increasing tyrosine aminotransferase (TAT) activity at concentrations up to 10^–5 M and then decreasing activity up to 10^–2 M but in all cases the activity is greater than that of the controls. This increase in activity is demonstrable for up to 6 h, the longest period tested, and is dependent on the synthesis of new mRNA. A similar increase in TAT activity is observed in salivary glands subjected to heat shock. Antibodies prepared against purified tyrosine aminotransferase precipitate a peptide of the same molecular weight (40 KD) as that induced by pyridoxine.     

Variant of human enzyme sequesters reactive intermediate

In cellular environments, coupled hydrolytic reactions are used to force efficient product formation in enzyme-catalyzed reactions. In the first step of protein synthesis, aminoacyl-tRNA synthetases react with amino acid and ATP to form an enzyme-bound adenylate that, in the next step, reacts with tRNA to form aminoacyl-tRNA. The reaction liberates pyrophosphate (PP(i)) which, in turn, can be hydrolyzed by pyrophosphatase to drive efficient aminoacylation. A potential polymorphic variant of human tryptophanyl-tRNA synthetase is shown here to sequester tryptophanyl adenylate. The bound adenylate does not react efficiently with the liberated PP(i) that normally competes with tRNA to resynthesize ATP and free amino acid. Structural analysis of this variant showed that residues needed for binding ATP phosphates and thus PP(i) were reoriented from their conformations in the structure of the more common sequence variant. Significantly, the reorientation does not affect reaction with tRNA, so that efficient aminoacylation is achieved.     

Activation of angiogenic signaling pathways by two human tRNA synthetases

Aminoacyl-tRNA synthetases establish the rules of the genetic code by joining amino acids to tRNAs that bear the anticodon triplets corresponding to the attached amino acids. The enzymes are thought to be among the earliest proteins to appear, in the transition from a putative RNA world to the theater of proteins. Over their long evolution, the enzymes have acquired additional functions that typically require specialized insertions or domain fusions. Recently, fragments of the closely related human tyrosyl- and tryptophanyl-tRNA synthetases were discovered to be active in angiogenesis signaling pathways. One synthetase fragment has proangiogenic activity, while the other is antiangiogenic. Activity was demonstrated in cell-based assays in vitro and in vivo in the chick embryo, and in the neonatal and adult mouse. The full-length, native enzymes are inactive in these same assays. Activation of angiogenesis activity requires fragment production from the native enzymes by protease cleavage or by translation of alternatively spliced pre-mRNA. Thus, these tRNA synthetases link translation to a major cell-signaling pathway in mammalian cells. The results with animals suggest that therapeutic applications are possible with these tRNA synthetases.     

Hepatitis B and C in the hemodialysis unit of Tocantins,Brazil: serological and molecular profiles

A survey was conducted in the hemodialysis population of the state of Tocantins, Brazil, aiming to assess the prevalence of hepatitis B virus (HBV) and hepatitis C virus (HCV) infections, to analyze associated risk factors, and also to investigate these viruses genotypes distribution. During January and March 2001, all patients (n = 100) were interviewed at the unique dialysis unit in Tocantins. Blood samples were collected and serum samples were screened for HBV serological markers. Hepatitis B surface antigen positive samples were tested for HBV DNA. All samples were also tested for anti-HCV antibodies and HCV RNA. An overall prevalence of 45% was found for HBV infection (4% were HBsAg/anti-HBc positive, 2% were anti-HBc only and 39% had anti-HBc/anti-HBs markers). Concerning HCV infection, anti-HCV and HCV RNA were detected in 13% and 14% of the subjects, respectively. Three patients were HCV RNA positive and anti-HCV negative, resulting in an overall HCV prevalence of 16%. Univariate analysis of risk factors showed that only shift and length of tile on hemodialysis were associated with HBV and HCV positivity respectively. Among the four HBsAg-positive samples, HBV DNA was detected in three of them, which were identified as genotype A by restriction fragment length polymorphism (RFLP) analysis. All 14HCV RNA-positive samples were genotyped by INNO-LiPA. Genotypes la and 3a were found in 85% and 15%, respectively. The present data show low HBsAg and HCV prevalence rates. The risk factors associated with HBV and HCV positivity suggest that nosocomial transmission may influence in spreading these viruses in the dialysis unit studied.