Quaternary uplifted coral reef terraces on Alor Island,East Indonesia

A flight of six major coral reef terraces, up to 700 m in altitude, occurs along the eastern and northern sides of Kabola Peninsula, Alor Island, Indonesia. Some radiometric dates have been obtained from unrecrystallized coral samples collected in growth position by three different methods (¹⁴C, ²³⁰Th/²³⁴U, ESR). This enabled the identification of the terraces corresponding to the Holocene and to oxygen-isotope stages 5c, 5e and 7. According to the present elevation of the dated terraces, a 1.0–1.2 mm/y mean rate of uplift can be discerned. Extrapolation of this trend to the whole sequence of terraces reveals a good correlation between the development of major terraces and interglacial or interstadial stages corresponding to astronomically calibrated oxygen isotope records, up to stage 13. The relatively rapid uplift rate in this region minimized the possibility of polycyclic sea-level stands at the same levels and contributed to the good preservation of some morphological reef features. Two superimposed marine notches are visible near the present shoreline, with retreat points at about 5.0 m and 8.6 m respectively above the present MLWST level. They can be interpreted as corresponding to a glacial interstadial (the upper notch) and to the Holocene sea-level peak (the lower one). As Holocene emergence has been less than what could be expected from a 1 mm/y rate of uplift, a major coseismic vertical displacement may occur in the future.This work is a contribution to the IGCP Project 367 Late Quaternary coastal records of rapid change and to the activities of the INQUA Commissions Neotectonics and Shorelines, the task group Paleoseismicity of the Late Holocene of the Inter-Union Commission on the Lithosphere, and the UNESCO-IUGS cooperative programme Earth Processes in Global Change (CLIP Pilot Project)     

Phylogeny of Greya (Lepidoptera: Prodoxidae), based on nucleotide sequence variation in mitochondrial cytochrome oxidase I and II: congruence with morphological data

The phylogeny of Greya Busck (Lepidoptera: Prodoxidae) was inferred from nucleotide sequence variation across a 765-bp region in the cytochrome oxidase I and II genes of the mitochondrial genome. Most parsimonious relationships of 25 haplotypes from 16 Greya species and two outgroup genera (Tetragma and Prodoxus) showed substantial congruence with the species relationships indicated by morphological variation. Differences between mitochondrial and morphological trees were found primarily in the positions of two species, G. variabilis and G. pectinifera, and in the branching order of the three major species groups in the genus. Conflicts between the data sets were examined by comparing levels of homoplasy in characters supporting alternative hypotheses. The phylogeny of Greya species suggests that host-plant association at the family level and larval feeding mode are conservative characters. Transition/transversion ratios estimated by reconstruction of nucleotide substitutions on the phylogeny had a range of 2.0-9.3, when different subsets of the phylogeny were used. The decline of this ratio with the increase in maximum sequence divergence among taxa indicates that transitions are masked by transversions along deeper internodes or long branches of the phylogeny. Among transitions, substitutions of A-->G and T-->C outnumbered their reciprocal substitutions by 2-6 times, presumably because of the approximately 4:1 (77%) A+T-bias in nucleotide base composition. Of all transversions, 73%-80% were A<-->T substitutions, 85% of which occurred at third positions of codons; these estimates did not decrease with an increase in maximum sequence divergence of taxa included in the analysis. The high frequency of A<-->T substitutions is either a reflection or an explanation of the 92% A+T bias at third codon positions.      

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër