Calculation of accurate small angle X-ray scattering curves from coarse-grained protein models

Background  

Genome sequencing projects have expanded the gap between the amount of known protein sequences and structures. The limitations of current high resolution structure determination methods make it unlikely that this gap will disappear in the near future. Small angle X-ray scattering (SAXS) is an established low resolution method for routinely determining the structure of proteins in solution. The purpose of this study is to develop a method for the efficient calculation of accurate SAXS curves from coarse-grained protein models. Such a method can for example be used to construct a likelihood function, which is paramount for structure determination based on statistical inference.     

A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Nanoplanktonic coccolithophorids (Prymnesiophyceae, Haptophyceae) from the Weddell Sea, Antarctica

The examination of whole mounts prepared for transmission electron microscopy has resulted in the finding of thirteen taxa of nanoplanktonic coccolithophorids from the Weddell Sea, Antarctica. The material was collected as part of the AMERIEZ programme, March 1986. Cold-water adapted nanoplanktonic coccolithophorids have previously been shown to constitute a recurrent plankton element at subarctic and arctic localities. Three of the Weddell Sea species, Wigwamma annulifera, W. arctica , and Papposphaera sagittifera , are conspecific with northern hemisphere material, while two species, Calciarcus alaskensis and Turrisphaera arctica , are possibly identical with previously described arctidsubarctic material. Six taxa new to science have been described from the Weddell Sea, Wigwamma antarctica, W. triradiata, Trigonaspis melvillea, Pappomonas weddellensis, Papposphaera obpyramidalis , and P. simplicissima . The cooccurrence of identical forms at the two poles, and the fact that the species described are allocated to "arctic" genera, indicate a geologically relatively recent exchange of biological material between the poles.     

Active human tissue plasminogen activator secreted from insect cells using a baculovirus vector

A baculovirus expression vector was constructed with the tissue plasminogen activator (TPA) cDNA under the control of the viral polyhedrin promoter. After infection of insect cells with the recombinant baculovirus, active TPA was secreted into the medium in which these cells were grown. TPA was isolated from the conditioned media using metal chelate affinity chromatography followed by immunoaffinity purification using mouse monoclonal anti-human TPA coupled to Sepharose. Sodium dodecyl sulfate-gel electrophoresis under reducing conditions and sequence analysis of recombinant human TPA have revealed a two-chain form of the enzyme. The N-terminal amino acid was identified to be serine, indicating that it was processed at its N-terminus by the insect cell culture in a manner similar to that observed for mammalian cells. The relative specific activity of recombinant TPA from insect cells is comparable to that of Bowes melanoma TPA standard. Its activity is stimulated in the presence of fibrinogen fragments, but by a factor about 2.3-fold lower than the Bowes melanoma TPA. The apparent molecular weight of recombinant TPA from insect cells was about 60K by fibrin agar activity gels, suggesting less complex glycosylation than recombinant TPA from mammalian cells.     

Serum immunoassay of a small cell lung cancer associated ganglioside: development of a sensitive scintillation proximity assay

We here report an enzyme linked immunosorbent assay (ELISA) and a scintillation proximity assay (SPA) for detection of the ganglioside FucGM₁ in sera from small cell lung cancer (SCLC) patients. The SPA was more sensitive and reproducible than the ELISA. In this assay, monoclonal antibodies specific for FucGM₁ were bound to SPA particles and incubated with labelled FucGM₁ and 100 µl test-serum overnight, and counted in a -counter. The sensitivity was 0.2 ng. Seven out of twenty sera from SCLC patients were positive, whereas none of twenty sera from healthy individuals were positive for FucGM₁. The SPA was more sensitive than the previously reported HPTLC as well as a direct ELISA.Abbreviations MAb monoclonal antibody - SPA scintillation proximity assay - HPTLC high performance thin layer chromatography - SCLC small cell lung cancer - FucGM₁ Fuc1-2Gal1-3GalNAc1-4(NeuAc2-3)-Gal1-4Glc1-1Cer - ELISA enzyme linked immunosorbent assay - FCS foetal calf serum - PBS phosphate buffered saline     

Hybrid Bacillus (1-3,1-4)-β-glucanases: engineering thermostable enzymes by construction of hybrid genes

Summary Hybrid (1-3,1-4)--glucanase genes were constructed by extension of overlapping segments of the (1-3,1-4)--glucanase genes from Bacillus amyloliquefaciens and B. macerans generated by the polymerase chain reaction (PCR). Four hybrid genes were expressed in Escherichia coli cells. The mature hybrid enzymes contain a 16, 36, 78, or 152 amino acid N-terminal sequence derived from B. amyloliquefaciens (1-3,1-4)--glucanase followed by a C-terminal segment derived from B. macerans (1-3,1-4)--glucanase. Biochemical characterization of parental and hybrid enzymes shows a significant increase in thermostability of three of the hybrid enzymes when exposed to an acidic environment thus combining two important enzyme characteristics within the same molecule. At pH 4.1, 85%-95% of the initial activity was retained after 1 h at 65° C in contrast to 5% and 0% for the parental enzymes from B. amyloliquefaciens and B. macerans. After 60 min incubation at 70° C, pH 6.0, the parental enzymes retained 5% or less of the initial activity whilst one of the hybrids still exhibited 90% of the initial activity. Of the parental enzymes B. macerans (1-3,1-4)--glucanase had the lower specific activity while the hybrid enzymes exhibited specific activities that were 1.5- to 3-fold higher. These experimental results demonstrate that exchange of homologous gene segments from different species may be a useful technique for obtaining new and improved versions of biologically active proteins.Abbreviations AMY mature form of Bacillus amyloliquefaciens (1-3,1-4)--glucanase; - MAC mature form of B. macerans (1-3,1-4)--glucanase - SUB mature form of B. subtilis (1-3,1-4)--glucanase - H(A16-M), H(A36-M), H(A78-M), H(A107-M), H(A152-M) mature forms of hybrid enzymes having 16, 36, 78, 107, 152 N-terminal amino acids, respectively, derived from AMY with the remaining amino acids derived from MAC