Optimization of speed and accuracy of decoding in translation

The speed and accuracy of protein synthesis are fundamental parameters for understanding the fitness of living cells, the quality control of translation, and the evolution of ribosomes. In this study, we analyse the speed and accuracy of the decoding step under conditions reproducing the high speed of translation in vivo. We show that error frequency is close to 10⁻³, consistent with the values measured in vivo. Selectivity is predominantly due to the differences in k_cat values for cognate and near-cognate reactions, whereas the intrinsic affinity differences are not used for tRNA discrimination. Thus, the ribosome seems to be optimized towards high speed of translation at the cost of fidelity. Competition with near- and non-cognate ternary complexes reduces the rate of GTP hydrolysis in the cognate ternary complex, but does not appreciably affect the rate-limiting tRNA accommodation step. The GTP hydrolysis step is crucial for the optimization of both the speed and accuracy, which explains the necessity for the trade-off between the two fundamental parameters of translation.     

A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Morphological embedding and phonetic reduction: the case of triconstituent compounds

In this paper we propose that the internal bracketing of a word with more than two morphemes is reflected in the phonetic implementation. We hypothesize that embedded forms show more phonetic reduction than forms at higher structural levels (‘Embedded Reduction Hypothesis’). This paper tests the prediction of the Embedded Reduction Hypothesis with triconstituent compounds. The analysis of the durational properties of almost 500 compound tokens shows that there is a lengthening effect on the non-embedded constituent, and a shortening effect on the adjacent embedded constituent. Yet, this predicted effect of embedding interacts with other lexical factors, above all the bigram frequency of the embedded compound. At a theoretical level, these effects mean that the durational properties of the cross-boundary constituents are indicative of the hierarchical structure and of the strength of the internal boundary of triconstituent compounds. Hence, morphological structure is reflected in the speech signal.     

Phytogeography of the bryophyte floras of oak forests and páramo of the Cordillera de Talamanca, Costa Rica

Aim Central America is a biogeographically interesting area because of its location between the rich and very different biota of North and South America. We aim to assess phytogeographical patterns in the bryophyte floras of oak forests and páramo of the Cordillera de Talamanca, Costa Rica. Location Tropical America, in particular the montane area of Cordillera de Talamanca, Costa Rica. Methods The analysis is based on a new critical inventory of the montane bryophyte flora of Cordillera de Talamanca. All species were assigned to phytogeographical elements on the basis of their currently known distribution. Absolute and percentage similarities were employed to evaluate floristic affinities. Results A total of 401 species [191 hepatics (liverworts), one hornwort, 209 mosses] are recorded; of these, 251 species (128 hepatics, one hornwort, 122 mosses) occur in oak forests. Ninety‐three per cent of all oak forest species are tropical in distribution, the remaining 7% are temperate (4%) and cosmopolitan (3%) species. The neotropical element includes almost 74% of the species, the wide tropical element (pantropical, amphi‐atlantic, amphi‐pacific) only 19%. A significant part of the neotropical species from oak forests are species with tropical Andean‐centred ranges (27%). As compared with bryophyte species, vascular plant genera in the study region are represented by fewer neotropical, more temperate and more amphi‐pacific taxa. Bryophyte floras of different microhabitats within the oak forest and epiphytic bryophyte floras on Quercus copeyensis in primary, early secondary and late secondary oak forest show a similar phytogeographical make‐up to the total oak forest bryophyte flora. Comparison of oak forest and páramo reveals a greater affinity of the páramo bryophyte flora to temperate regions and the great importance of the páramo element in páramo. Surprisingly, oak forests have more Central American endemics than páramo. Main conclusions (1) Providing first insights into the phytogeographical patterns of the bryophyte flora of oak forests and páramo, we are able to confirm general phytogeographical trends recorded from vascular plant genera of the study area although the latter were more rich in temperate taxa. (2) Andean‐centred species are a conspicuous element in the bryophyte flora of Cordillera de Talamanca, reflecting the close historical connection between the montane bryophyte floras of Costa Rica and South America. (3) High percentages of Central American endemics in the bryophyte flora of the oak forests suggest the importance of climatic changes associated with Pleistocene glaciations for allopatric speciation.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

A light and electron microscopic study of the quadriflagellate green algaSpermatozopsis exsultans

The green flagellateSpermatozopsis exsultans Korshikov has been studied in culture by light and electron microscopy. The organism is naked, bears four flagella and is conspicuously spirally twisted. The ultrastructure and location of cell organelles (except the flagellar apparatus) has been investigated in detail using an absolute configuration analysis. With the exception of a doubling of the flagella and of the secondary cytoskeletal microtubule system,S. exsultans has the exact same complement of organelles occupying the same relative positions as has been described forS. similis. The two species are therefore correctly placed in the same genus. The usefulness of absolute orientations of cell organelles for green algal taxonomy and phylogeny is stressed.Dedicated to Prof.M. Mix on the occasion of her 60th birthday.