The Detection of Hamster Connexins: A Comparison of Expression Profiles with Wild-Type Mouse and the Cancer-Prone Min Mouse

The open reading frames of 17 connexins from Syrian hamster (using tissues) and 16 connexins from the Chinese hamster cell line V79, were fully (Cx30, Cx31, Cx37, Cx43 and Cx45) or partially sequenced. We have also detected, and partially sequenced, seven rat connexins that previously were unavailable. The expression of connexin genes was examined in some hamster organs and cultured hamster cells, and compared with wild-type mouse and the cancer-prone Min mouse. Although the expression patterns were similar for most organs and connexins in hamster and mouse, there were also some prominent differences (Cx29 and 30.3 in testis; Cx31.1 and 32 in eye; Cx46 in brain, kidney and testis; Cx47 in kidney). This suggests that some connexins have species-specific expression profiles. In contrast, there were minimal differences in expression profiles between wild type and Min mice. Species-specific expression profiles should be considered in attempts to make animal models of human connexin-associated diseases.     

Transmission of a New Mycoplasma-Like Organism (MLO) from Cuscuta odorata (Ruiz et Pav.) to Herbaceous Plants and Attempts to its Elimination in the Vector

A new MLO-type, originating from a holoparasite plant Cuscuta odorata (Ruiz et Pav.) causing stunting and reduction of flower- and leaf size on Catharanthus roseus (L.) G. Don. (HEINTZ 1986) was transmitted to Apium graveolens L., Plantago major L., Bellis perennis L. and Cirsium japonicum hybrid. The observed symptoms on the test plants probably caused by the MLO have not yet been described in the literature. The symptomatology on these herbaceous plants gives further data in order to classify the MLO as a new one which is named Guscuta latent MLO (Cl-MLO). Attempts to transmit the pathogens by the leafboppers Euscelidius variegates (Kirschbaum) and Euscelis lineolatus (Brullé) failed. It also was impossible to elimmate the MLO completely from Cuscuta odorata by heat treatment and antibiotic application. However, we succeeded in eliminating the pathogens from Catharanthus roseus by heat treatment.     

Comparative effects of trichothecene mycotoxins on bovine platelet function: Acetyl T-2 toxin,a more potent inhibitor than T-2 toxin

The effects of the trichothecene mycotoxins (acetyl T-2 toxin, T-2 toxin, HT-2 toxin, palmityl T-2 toxin, diacetoxyscirpenol (DAS), deoxynivalenol (DON), and T-2 tetraol) on bovine platelet function were examined in homologous plasma stimulated with platelet activating factor (PAF). The mycotoxins inhibited platelet function with the following order of potency: acetyl T-2 toxin > palmityl T-2 toxin = DAS > HT-2 toxin = T-2 toxin. While T-2 tetraol was completely ineffective as an inhibitor, DON exhibited minimal inhibitory activity at concentrations above 10×10^?4M. The stability of the platelet aggregates formed was significantly reduced in all mycotoxin treated platelets compared to that of the untreated PAF controls. It is suggested that the increased sensitivity of PAF stimulated bovine platelets to the more lipophilic mycotoxins may be related to their more efficient partitioning into the platelet membrane compared to the more hydrophilic compounds.     

An extensive review on antifungal approaches in the treatment of mucormycosis

During the period of COVID-19, the occurrences of mucormycosis in immunocompromised patients have increased significantly. Mucormycosis (black fungus) is a rare and rapidly progressing fungal infection associated with high mortality and morbidity in India as well as globally. The causative agents for this infection are collectively called mucoromycetes which are the members of the order Mucorales. The diagnosis of the infection needs to be performed as soon as the occurrence of clinical symptoms which differs with types of Mucorales infection. Imaging techniques magnetic resonance imaging or computed tomography scan, culture testing, and microscopy are the approaches for the diagnosis. After the diagnosis of the infection is confirmed, rapid action is needed for the treatment in the form of antifungal therapy or surgery depending upon the severity of the infection. Delaying in treatment declines the chances of survival. In antifungal therapy, there are two approaches first-line therapy (monotherapy) and combination therapy. Amphotericin B ( 1 ) and isavuconazole ( 2 ) are the drugs of choice for first-line therapy in the treatment of mucormycosis. Salvage therapy with posaconazole ( 3 ) and deferasirox ( 4 ) is another approach for patients who are not responsible for any other therapy. Adjunctive therapy is also used in the treatment of mucormycosis along with first-line therapy, which involves hyperbaric oxygen and cytokine therapy. There are some drugs like VT-1161 ( 5 ) and APX001A ( 6 ), Colistin, SCH 42427, and PC1244 that are under clinical trials. Despite all these approaches, none can be 100% successful in giving results. Therefore, new medications with favorable or little side effects are required for the treatment of mucormycosis.     

La question de la sensibilité des Abeilles A l'ultra-violet

Zusammenfassung Es wurde die Reaktion von Bienen auf monochromatische Lichter und variabler Intensität im Spektrum von 300 bis 665 m untersucht. Das Spaltbild eines Spektrographen wurde auf die Wand einer Versuchskammer vergrössert abgebildet. Als Test der Reaktion wurde die Zahl der Bienen genommen die während einer vorgegebenen Zeit auf das Spaltbild zugehen und ihm entlanglaufen.Dabei ergaben sich folgende Resultate: 1) Eine lineare Abhängigkeit zwischen der Reaktionszahl und dem Logarithmus der verwendeten Spektralenergie für alle verwendeten monochromatischen Lichter. 2) Eine spektrale Empfindlichkeitskurve mit zwei Maxima bei 550 und bei 365 m. Das Letztere ist etwa doppelt so intensif wie das im Sichtbaren.Die gefundenen Resultate bestätigen z. Teil die Resultate Bertholf's und ergänzen sie. Es konnte gezeigt werden, warum bei Sander das Max. bei 365 m nicht auftritt.Weiterhin konnte nachgewiesen werden, dassApis mellifica keinerlei Lichthautsinn besitzt.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.