Proteinase Inhibitor II Gene Expression Induced by Electrical Stimulation and Control of Photosynthetic Activity in Tomato Plants

Mechanical damage and heat stimulation were used to activateproteinase inhibitor II (Pin2) gene expression in tomato plantsin both treated (local induction) and non-treated tissues (systemicinduction). Both stimuli have been shown to generate electricalsignals, leading to a systemic activation of gene expression.Treatment of tomato leaves with electrical current resultedin the accumulation of Pin2 mRNA in the local and systemic leaves.Additionally, all treatments inducing Pin2 gene activity gaverise to a significant alteration of stomatal aperture. However,heat stimulation provoked a different response in the stomatalparameters than mechanical wounding or electric treatment. Bothmechanical damage and electrical stimulation activated two characteristictime constants in the gas exchange relaxation kinetics. Conversely,heat stimulation resulted in only one major time constant. Theresults clearly show that direct current application to tomatoleaves initiates Pin2 mRNA accumulation locally and systemically.In addition, they suggest the participation of a second slowelectrical/hydraulic component in the wound response mechanismof tomato plants and a possible alternative pathway regulatingheat-induced Pin2 gene expression. (Received February 13, 1995; Accepted April 14, 1995)     

Increases in α-mannosidase activity in the arbuscular mycorrhizal symbiosis of Allium schoenoprasum

 Mycorrhizal and nonmycorrhizal roots of Allium schoenoprasum were tested for activities of α-mannosidase, β-glucosidase and arabinosidase. Mannosidase activity was higher by a factor of two in mycorrhizal than in nonmycorrhizal root extracts. The apparent molecular weight of the enzyme was 152 kDa and its K_M was 1.25 mM in colonized roots and 1.85 mM in uncolonized roots. α-Mannosidase activity was further characterized by an acid pH optimum and Zn²⁺ dependency. No significant differences could be found between mycorrhizal and nonmycorrhizal roots for β-glucosidase and arabinosidase activities. Accepted: 28 August 1995     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Enhancement of specific nitrogenase activity inAzospirillum brasilense andKlebsiella pneumoniae,inhibition inRhizobium japonicum under air by phenol

Specific nitrogenase activity inAzospirillum brasilense ATCC 29145 in surface cultures under air is enhanced from about 50 nmol C₂H₄·mg protein^-1·h^-1 to 400 nmol C₂H₄ by the addition of 1 mM phenol. 0.5 and 2 mM phenol added increase the rate 5-fold and 4-fold. This enhancement effect is observed only between 2 and 3 days after inoculation, with only a small reduction of the growth of the cells by the phenol added. In surface cultures under 1% O₂, nitrogenase activity is slightly reduced by the addition of 1–0.01 mM phenol. Utilization of succinate is enhanced during the period of maximum enhancement of nitrogenase activity by 60% by addition of 1 mM phenol. The cells did not produce¹⁴CO₂ from [U-¹⁴C] phenol, neither in surface cultures nor in liquid cultures and less than 0.1% of the phenol was incorporated into the cells. A smaller but significant enhancement of nitrogenase activity by about 100% in surface cultures under air was found withKlebsiella pneumoniae K 11 after addition of 1 mM phenol. However, inRhizobium japonicum 61-A-101 all phenol concentrations above 0.01 mM reduced nitrogenase activity. With 1 mM phenol added activity was reduced to less than 10% with no effect on the growth in the same cultivation system. With thisRhizobium japonicum strain significant quantities of phenol (25 mol in 24 h by 2·10¹² cells) were metabolized to¹⁴CO₂, with phenol as sole carbon source. WithAzospirillum brasilense in liquid culture under 1% and 2% O₂ in the gas phase, no enhancement of nitrogenase activity by phenol was noticed.     

Estimating the contribution of assembly activity to cortical dynamics from spike and population measures

The hypothesis that cortical networks employ the coordinated activity of groups of neurons, termed assemblies, to process information is debated. Results from multiple single-unit recordings are not conclusive because of the dramatic undersampling of the system. However, the local field potential (LFP) is a mesoscopic signal reflecting synchronized network activity. This raises the question whether the LFP can be employed to overcome the problem of undersampling. In a recent study in the motor cortex of the awake behaving monkey based on the locking of coincidences to the LFP we determined a lower bound for the fraction of spike coincidences originating from assembly activation. This quantity together with the locking of single spikes leads to a lower bound for the fraction of spikes originating from any assembly activity. Here we derive a statistical method to estimate the fraction of spike synchrony caused by assemblies—not its lower bound—from the spike data alone. A joint spike and LFP surrogate data model demonstrates consistency of results and the sensitivity of the method. Combining spike and LFP signals, we obtain an estimate of the fraction of spikes resulting from assemblies in the experimental data.     

Palynology of the perigoniate Aroideae: Zamioculcas,Gonatopus and Stylochaeton (Araceae)

The pollen of the perigoniate Aroideae sensu Mayo et al. (1997) ( Zamioculcas Schott, Gonatopus Hook. f. ex Engl. and Stylochaeton Lepr.) differs ultrastructurally from that of the aperigoniate Aroideae in several important exine and aperture characters. The almost identical zona-aperturate pollen of Zamioculcas and Gonatopus has outside the aperture an elaborated, thick ectexine, while the aperture consists of a thin, but continuous ectexine and a thick, lamellate endexine. In contrast, the omniaperturate pollen of Stylochaeton has a thin, not clearly stratified ectexine and a thin, heterogeneous endexine below. However, the zona-aperturate pollen of Zamioculcas and Gonatopus deviates significantly from the superficially similar zona-aperturate pollen of the unrelated Monstereae (e. g., Monstera Adans., Amydrium Schott): in the apertures of Monstera or Amydrium both the thin, but continuous ectexine and the lamellate endexine, which are typical features for Zamioculcas and Gonatopus , are absent. The palynological data underline not only the present classification of Zamioculcas , Gonatopus and of Stylochaeton into two tribes (Zamioculcadeae and Stylochaetoneae) and the differences of both tribes from the other Aroideae, but show also significant deviations in the respective zona-aperturate condition in Monstereae (Monsteroideae) and Zamioculcadeae (Aroideae).