Phenotypic and functional characterization of cytotoxic cells derived from endomyocardial biopsies in human cardiac allografts.

This study was undertaken to characterize the phenotype and function of lymphocytes derived from endomyocardial biopsies in heart transplant patients. To this aim, tissue infiltrating lymphocytes were derived from seven heart transplant patients and were analyzed for the expression of a panel of markers, including CD3, CD4, CD8, CD16, CD56, CD45RA, CD45RO, alpha/beta and gamma/delta T cell receptor, and for their ability to lyse a series of targets, including NK-sensitive K-562 targets, NK-resistant Raji targets, donor related, and unrelated normal splenocytes. Our data show that the majority of cultured lymphocytes expressed the CD3+ phenotype and the alpha/beta T cell receptor. The CD4 and CD8 molecules were heterogeneously expressed among T cell lines tested. Concerning cytotoxic related markers, a significant percentage of cells were CD56+. The evaluation of CD45 isoforms showed that both "naive" and "memory" cells were present among heart TIL. Cytotoxic in vitro studies demonstrated that all our T cell lines showed an efficient cytotoxic machinery when tested against NK-sensitive targets. A marked lysis of donor-related splenocytes was demonstrated in all patients tested. To investigate the role of CD3 and HLA class I molecules in the cytotoxic mechanisms taking place in human heart allograft rejection mechanisms, TIL were assessed for their lytic activity against different targets in the presence of anti-CD3 and anti-HLA class I monoclonal antibodies (mAbs). Although donor-specific cytotoxicity was considerably inhibited by the anti-CD3 mAb, no inhibitory effect was displayed by this antibody on TIL-mediated cytotoxicity against donor-unrelated splenocytes. Anti-HLA class I mAb was able to inhibit both allospecific and nonallospecific cytotoxicity. These data suggest that different types of cytotoxic cells may be propagated from biopsy specimens of heart transplant patients.     

Active and late rosette-forming cells: immunological and cytochemical characterization

In order to characterize T-cell subpopulations with different affinities for sheep red blood cells, a possible correlation between active and late rosette-forming cells (RFC), expression of Fc receptors, and the presence of Ia antigens was investigated. Further analysis of their spontaneous in vitro DNA synthesis, and their cytochemical pattern was also performed. Most of the active T cells lacked Fc receptors and expressed Ia antigens, whereas the large majority of cells with Fc-IgG and -IgM receptors were included as late T cells, but lacked Ia determinants. Analysis of spontaneous blastogenesis showed that late RFC, but not active RFC, synthesize DNA in unstimulated cultures. Cytochemical analysis suggested that Active RFC display a more immature phenotype compared to late RFC, which have enzymatic markers present in mature T cells. Possible interpretations of these findings are discussed.     

Retinol (Vitamin A) Increases α-Synuclein, β-Amyloid Peptide,Tau Phosphorylation and RAGE Content in Human SH-SY5Y Neuronal Cell Line

Retinoids (vitamin A and derivatives) are recognized as essential factors for central nervous system (CNS) development. Retinol (vitamin A) also was postulated to be a major antioxidant component of diet as it modulates reactive species (RS) production and oxidative stress in biological systems. Oxidative stress plays a major role either in pathogenesis or development of neurodegenerative diseases, or even in both. Here we investigate the role of retinol supplementation to human neuron-derived SH-SY5Y cells over RS production and biochemical markers associated to neurodegenerative diseases expressed at neuronal level in Parkinson’s disease and Alzheimer’s disease: α-synuclein, β-amyloid peptide, tau phosphorylation and RAGE. Retinol treatment (24 h) impaired cell viability and increased intracellular RS production at the highest concentrations (7 up to 20 µM). Antioxidant co-treatment (Trolox 100 µM) rescued cell viability and inhibited RS production. Furthermore, retinol (10 µM) increased the levels of α-synuclein, tau phosphorylation at Ser396, β-amyloid peptide and RAGE. Co-treatment with antioxidant Trolox inhibited the increased in RAGE, but not the effect of retinol on α-synuclein, tau phosphorylation and β-amyloid peptide accumulation. These data indicate that increased availability of retinol to neurons at levels above the cellular physiological concentrations may induce deleterious effects through diverse mechanisms, which include oxidative stress but also include RS-independent modulation of proteins associated to progression of neuronal cell death during the course of neurodegenerative diseases.     

The oxidation of HSP70 is associated with functional impairment and lack of stimulatory capacity

Expression of intracellular HSP70 is associated with cytoprotective effects against a wide range of stressful stimuli, such as inflammation, oxidative stress, hypoxia, endotoxins, infections, and fever. This cytoprotective effect is mainly attributed to their ability to stabilize protein structures through chaperone-like reversible interactions. HSP70 was recently detected in the extracellular medium, and its presence in serum is commonly associated with pathological situations, where it exerts modulatory effects on cells of the immune system. Previously, we have described the relationship between serum HSP70 levels, oxidant status, and clinical outcome of septic patients; the group of patients with higher prooxidant status and higher serum HSP70 had also higher mortality. To investigate the possible association between oxidized HSP70 and cytoprotection or cell death, we incubated RAW 264.7 macrophages with oxidized HSP70 and evaluated nitrite production, cell proliferation, cell viability, TNF-α release, and phagocytic activity. We also evaluated structural modifications caused by oxidation in purified HSP70. Oxidation of HSP70 altered its protein structure; besides, the modulatory effect of oxidized HSP70 on RAW264.7 cells was different from that of native HSP70. Macrophages treated with oxidized HSP70 presented lower proliferation and viability, lower phagocytic activity, and lower TNF-α release. These results indicate that oxidation of extracellular HSP70 modified its signaling properties, causing alterations on its modulatory effects on macrophage function and viability.     

L-NAME co-treatment prevent oxidative damage in the lung of adult Wistar rats treated with vitamin A supplementation

Based on the fact that vitamin A in clinical doses is a potent pro-oxidant agent to the lungs, we investigated here the role of nitric oxide (NO?) in the disturbances affecting the lung redox environment in vitamin A-treated rats (retinol palmitate, doses of 1000-9000 IU?kg(-1)?day(-1)) for 28 days. Lung mitochondrial function and redox parameters, such as lipid peroxidation, protein carbonylation and the level of 3-nytrotyrosine, were quantified. We observed, for the first time, that vitamin A supplementation increases the levels of 3-nytrotyrosine in rat lung mitochondria. To determine whether nitric oxide (NO ?) or its derivatives such as peroxynitrite (ONOO-) was involved in this damage, animals were co-treated with the nitric oxide synthase inhibitor L-NAME (30 mg?kg(-1), four times a week), and we analysed if this treatment prevented (or minimized) the biochemical disturbances resulting from vitamin A supplementation. We observed that L-NAME inhibited some effects caused by vitamin A supplementation. Nonetheless, L-NAME was not able to reverse completely the negative effects triggered by vitamin A supplementation, indicating that other factors rather than only NO? or ONOO- exert a prominent role in mediating the redox effects in the lung of rats that received vitamin A supplementation.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Effect of N-salicyloyltryptamine (STP), a novel tryptamine analogue, on parameters of cell viability, oxidative stress, and immunomodulation in RAW 264.7 macrophages

Immunomodulatory actions exerted by some classes of tryptamines, such as benzoyltryptamine analogues, suggest these molecules as promising candidates to develop new therapies to treat conditions associated to acute and chronic pain and inflammation. N-salicyloyltryptamine (STP) was observed to act as an anticonvulsive agent and exert antinociceptive effects in mouse. In the present work, we performed a screening of cytotoxic, cytoprotective, immunomodulatory, and redox properties of STP in RAW 264.7 macrophages challenged with hydrogen peroxide and LPS. Our results show that STP presents no cytotoxicity in the range of 0.001 to 1 μg/mL, but doses of 50 and 100 μg/mL caused loss of cell viability (IC₅₀?=?22.75 μg/mL). Similarly, STP at 0.001 to 1 μg/mL did not cause oxidative stress to RAW 264.7 cells, although it did not prevent cell death induced by H₂O₂ 0.5 mM. At 1 μg/mL, STP reversed some redox and inflammatory parameters induced by LPS. These include thiol (sulfhydryl) oxidation, superoxide dismutase activation, and morphological changes associated to macrophage activation. Besides, STP significantly inhibited LPS-induced TNF-α and IL-1β release, as well as CD40 and TNF-α protein upregulation. Signaling events induced by LPS, such as phosphorylation of ERK 1/2 and IκBα and p65 nuclear translocation (NF-kB activation) were also inhibited by STP. These data indicate that STP is able to modulate inflammatory parameters at doses that do not interfere in cell viability.     

Differences between glycogen biogenesis in fast- and slow-twitch rabbit muscle

Skeletal muscle glycogen is an essential energy substrate for muscular activity. The biochemical properties of the enzymes involved in de novo synthesis of glycogen were analysed in two types of rabbit skeletal muscle fiber (fast- and slow-twitch). Glycogen concentration was higher in fast-twitch muscle than in slow-twitch muscle, but the latter contained many more small intermediate-acceptor molecules that could act as glycogen synthase substrates. The enzymes involved in de novo synthesis of glycogen in fast-twitch muscle were strongly stimulated by Glc-6-P, but those in slow-twitch muscle were not.     

A step forward in the genome characterization of the sugarcane borer,Diatraea saccharalis: karyotype analysis,sex chromosome system and repetitive DNAs through a cytogenomic approach

Chromosoma - Moths of the family Crambidae include a number of pests that cause economic losses to agricultural crops. Despite their economic importance, little is known about their genome...