Cloning of rat brain succinyl-CoA:3-oxoacid CoA-transferase cDNA. Regulation of the mRNA in different rat tissues and during brain development.

3-Oxoacid CoA-transferase, which catalyses the first committed step in the oxidation of ketone bodies, is uniquely regulated in developing rat brain. Changes in 3-oxoacid CoA-transferase activity in rat brain during the postnatal period are due to changes in the relative rate of synthesis of the enzyme. To study the regulation of this enzyme, we identified, with a specific polyclonal rabbit anti-(rat 3-oxoacid CoA-transferase), two positive cDNA clones (approx. 800 bp) in a lambda gtll expression library, constructed from poly(A)+ RNA from brains of 12-day-old rats. One of these clones (lambda CoA3) was subcloned into M13mp18 and subjected to further characterization. Labelled single-stranded probes prepared by primer extension of the M13mp18 recombinant hybridized to a 3.6 kb mRNA. Rat brain mRNA enriched by polysome immunoadsorption for a single protein of size 60 kDa which corresponds to the precursor form of 3-oxoacid CoA-transferase was also found to be similarly enriched for the hybridizable 3.6 kb mRNA complementary to lambda CoA3. Affinity-selected antibody to the lambda CoA3 fusion protein inhibited 3-oxoacid CoA-transferase activity present in rat brain mitochondrial extracts. The 3.6 kb mRNA for 3-oxoacid CoA-transferase was present in relative abundance in rat kidney and heart, to a lesser extent in suckling brain and mammary gland and negligible in the liver. The specific mRNA was also found to be 3-fold more abundant in the brain from 12-day-old rats as compared with 18-day-old foetuses and adult rats, corresponding to the enzyme activity and relative rate of synthesis profile during development. These data suggest that 3-oxoacid CoA-transferase enzyme activity is regulated at a pretranslational level.     

Effect of auxins and cytokinins on plant regeneration from hypocotyls and cotyledons in niger (Guizotia abyssinica Cass.)

Tissue cultures were established from hypocotyl and cotyledonary leaf segments ofGuizotia abyssinica Cass. on MS medium supplemented with various concentrations of auxins (IAA, NAA, IBA or 2,4-D) and cytokinins (KN or BA). Expiants cultured on media with cytokinins or in combination with auxins produced shoot buds. Maximum number of shoot buds (20–25 per culture) were differentiated from cotyledonary leaf segments on medium with 2 mg 1^-1 each of KN and IBA. Rooting of regenerated shoot buds was acheived on medium with NAA. The obtained plantlets were successfully transferred to soil.     

Effects of cytokine combinations on acute phase protein production in two human hepatoma cell lines.

We evaluated the effects of binary combinations of four cytokines on production of the positive acute phase proteins alpha-1 antichymotrypsin, haptoglobin and fibrinogen, and the negative acute phase proteins albumin and alpha-fetoprotein (AFP) in two human hepatoma cell lines. The effects of the cytokine combinations on the five proteins varied; each protein exhibited a unique and specific pattern of response to the cytokine combinations. In Hep G2 cells, antichymotrypsin was induced by all four cytokines, IL-6, IL-1, TNF-alpha, and transforming growth factor beta 1 alone, and their effects in binary combinations could be attributed to additive or minimally synergistic interactions. Fibrinogen was induced only by IL-6 and this induction was inhibited by IL-1 alpha, TNF-alpha or transforming growth factor beta 1. Haptoglobin was also induced only by IL-6, but TNF-alpha was the only cytokine that inhibited this induction at all concentrations of IL-6. Each of the four cytokines alone down regulated production of AFP and albumin. However, binary combinations of the four cytokines were simply additive, for the most part, in inhibiting AFP production, whereas the inhibitory effects of combinations of cytokines on albumin production differed significantly from simple additive effects. These observations, taken together with studies of effects of cytokine combinations on other acute phase proteins, indicate that the various acute phase proteins respond differently to different combinations of cytokines and that the potential exists for highly specific regulation of synthesis of individual plasma proteins by cytokine interactions. These findings imply that the acute phase response in vivo represents the integrated sum of multiple, separately regulated changes in gene expression.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

USE OF THE SODIUM SALT GLYCOSYLATION HETBOD IN NUCLEOSIDE SYNTHESIS

Abstract

A general and stereospecific method has been developed for the direct preparation of βD-ribofuranosyl, βD-arabinofuranosyl and 2-deoxy-βD-erythro-pentofuranosyl derivatives of a number of nitrogen heterocycles. The azoles thus far employed include appropriately substituted pyrrole, pyrazole, imidazole, 1,2,4-triazole, indole, imidazo[4,5-c]pyridine, pyrrolo[2,3-d]pyrimidine, pyrro10[3,2-c]pyridine, pyrrolo[4,2-c]pyrimidine, purine, pyrazolo[3,4-b]pyridine and pyrazolo-[3,4-d]pyrimidine. This simple high-yield methodology provided a facile route to the large-scale preparation of biologically significant nucleo-sides, such as 2′-deoxyribavirin, 2-chloro-2′-deoxyadenosine, tuber-cidin, Z'-deoxytubercidin, =sangivarnycin, 2′-deoxytoyocamycin, cade-guomycin, 2′-deoxycadeguomycin, G-cadeguomycin, kanagawamicin, 2′-deoxy-3-deazaguanosine, sG, brunfelsarnidine ribonucleoside and 2′-deoxyribofuranosyl derivative of the antibiotic SF-2140. This procedure appears to be considerably superior to the previously reported glycosylation methods.     

Synthesis of Brunfelsamidine Ribonucleoside and Certain Related Compounds by the Stereospecific Sodium Salt Glycosylation Procedure

Abstract

A synthesis of 2,4-dideazaribavirin ( 2 ), brunfelsamidine ribonucleoside ( 8c ) and certain related derivatives are described for the first time using the stereospecific sodium salt glycosylation procedure. Glycosylation of the sodium salt of pyrrole-3-carbonitrile ( 4 ) with 1-chloro-2, 3-O-t-isopropylidene-5-O-t-butyldimethylsilyl-α-D-ribofuranose ( 5 ) gave exclusively the corresponding blocked nucleoside ( 6 ) with β-anomeric configuration, which on deprotection provided 1-β-D-ribofuranosylpyrrole-3-carbonitrile ( 7 ). Functional group tranformation of 7 gave 2 , 8c and related 3-substituted pyrrole ribonucleosides. These compounds are devoid of any significant antiviral/antitumor activity invitro.     

Sucrose-inducible expression of hepatitis B surface antigen using potato granule-bound starch synthase promoter

NT-1 cells of tobacco (Nicotiana tabacum L.) were transformed with pGBSSHBS and pGBSSHER expression cassettes wherein expression of hepatitis B surface antigen (HBsAg) was driven by potato granule-bound starch synthase (GBSS) promoter. The transformed nature of the cells was confirmed by PCR analysis. Expression of HBsAg was confirmed by RT-PCR and Western blotting and levels of expression were assayed by ELISA. Transformed cell lines exhibited a sucrose-inducible pattern of HBsAg expression. NT-1 medium supplemented with 175 mmol L⁻¹ sucrose gave the highest HBsAg expression of 198 ng g⁻¹ FW after 8 days of induction. Different sugars, for example glucose, fructose, and palatinose, were also tested to study the inducible nature of GBSS promoter. The results demonstrate that potato GBSS promoter can be used in heterologous host systems like tobacco NT-1 cell suspension cultures for sucrose-inducible expression of recombinant proteins.     

Effect of extracellular magnesium on topoisomerase II activity and expression in human leukemia HL-60 cells

Topoisomerase II (TopoII) is a Mg-dependent enzyme involved in topological modifications of DNA that are crucial to the regulation of cell proliferation and possibly differentiation. To investigate the role of Mg availability in the modulation of TopoII in whole cells, we studied enzyme activity and expression in HL-60 cells grown in the presence of decreasing amounts of extracellular Mg (0.5, 0.03, and 0.01 mM MgSO(4)). In comparison to cells grown in 0.5 mM Mg, cells grown in 0.03 mM Mg exhibited a decrease in TopoII activity, as evidenced by reduced induction of DNA/TopoII cleavable complexes and apoptosis by etoposide and teniposide. Enzyme activity was restored by the readdition of Mg (0.5 and 1.5 mM) in the incubation medium, confirming that this effect was indeed modulated by extracellular Mg. Restriction of Mg to 0.01 mM was associated with a dramatic decrease in TopoII activity resembling that observed in HL-60 cells differentiated by dimethyl sulfoxide treatment. The restriction of Mg, while decreasing enzyme activity, was found to upregulate TopoII protein expression, determined by Western blot analysis. The increase of TopoII protein levels was correlative with the degree of Mg deprivation. Collectively, these results indicate that extracellular levels of Mg may control availability of intracellular Mg, thus affecting the regulation of TopoII activity/expression and downstream processes of cell proliferation and/or differentiation.