Differential response to hepatic differentiation stimuli of amniotic epithelial cells isolated from four regions of the amniotic membrane

Human Amniotic Epithelial Cells (hAEC) isolated from term placenta are a promising source for regenerative medicine. However, it has long been debated whether the hAEC population consists of heterogeneous or homogeneous cells. In a previous study, we investigated the characteristics of hAEC isolated from four different regions of the amniotic membrane finding significant heterogeneity. The aim of this study was to evaluate the hepatic differentiation capability of hAEC isolated from these four regions. Human term placentae were collected after caesarean section and hAEC were isolated from four regions of the amniotic membrane (R1-R4, according to their relative distance from the umbilical cord) and treated in hepatic differentiation conditions for 14 days. hAEC-derived hepatocyte-like cells showed marked differences in the expression of hepatic markers: R4 showed higher levels of Albumin and Hepatocyte Nuclear Factor (HNF) 4α whereas R1 expressed higher Cytochrome P450 enzymes, both at the gene and protein level. These preliminary results suggest that hAEC isolated from R1 and R4 of the amniotic membrane are more prone to hepatic differentiation. Therefore, the use of hAEC from a specific region of the amniotic membrane should be taken into consideration as it could have an impact on the outcome of therapeutic applications.     

Stabilization of Z-RNA by chemical bromination and its recognition by anti-Z-DNA antibodies

Limited chemical bromination of poly[r(C-G)] (32% br8G, 26% br5C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. More extensive bromination of poly[r(C-G)] (greater than 49% br8G, 43% br5C) results in stabilization of a form of RNA having a Z-DNA-like (ZD) CD spectrum in low-salt, pH 7.0-7.5 buffers. Raising the ionic strength to 6 M NaBr or NaClO4 results in a transition in Br-poly[r(C-G)] to a Z-RNA (ZR) conformation as judged by CD spectroscopy. At lower ionic strength Z-DNA-like (ZD) and A-RNA conformations are also present. 1H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37 degrees C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', and CH1' resonances in both the A- and Z-forms. GH8----GH1' NOEs demonstrate the presence of both A- and Z-form GH8 resonances in slow exchange on the NMR time scale. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 degrees C. Comparison with the spectrum of Z-DNA indicates that there may be different glycosidic torsion angles in Z-RNA and Z-DNA [Tinoco, I., Jr., Cruz, P., Davis, P., Hall, K., Hardin, C. C., Mathies, R. A., Puglisi, J. D., Trulson, M. O., Johnson, W. C., & Neilson, T. (1986) in Structure and Dynamics of RNA, pp 55-68, Plenum, New York].(ABSTRACT TRUNCATED AT 250 WORDS)     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Molecular Cloning of the N-Terminus of GTBP

Defects in mismatch repair genes cause the genetic instability characteristic of hereditary nonpolyposis colorectal cancer and a subset of sporadic colon tumors. The newest member of the mismatch repair gene family,GTBP, has recently been identified as a partial cDNA. Here, we describe the isolation of its 5′ terminus, allowing definition of the entire coding region. Several polymorphisms within the 5′ end were identified and are presented.     

Intergenic spacers of rRNA genes in three species of theCynareae (Asteraceae)

Intergenic spacers of the rRNA genes of three species of theCynareae tribe:Cynara cardunculus subsp.scolymus (artichoke),Onopordum acanthium, andO. illyricum were cloned in the plasmid pGEM-7zf(+). Detailed restriction mapping and partial sequencing of the IGSs were carried out. The structural analysis showed a clear diversity betweenCynara andOnopordum, while a high degree of homology was found between the twoOnopordum spp. In all three species a fragment of about 450 bp from the 5 end of 18S to the Acc I site with a high sequence homology was present. Nucleotide sequences upstream from the above mentioned Acc I site show a gradual decrease of homology betweenCynara andOnopordum.     

Energy cost of walking and gait instability in healthy 65- and 80-yr-olds.

This study tested whether the lower economy of walking in healthy elderly subjects is due to greater gait instability. We compared the energy cost of walking and gait instability (assessed by stride to stride changes in the stride time) in octogenarians (G80, n = 10), 65-yr-olds (G65, n = 10), and young controls (G25, n = 10) walking on a treadmill at six different speeds. The energy cost of walking was higher for G80 than for G25 across the different walking speeds (P < 0.05). Stride time variability at preferred walking speed was significantly greater in G80 (2.31 +/- 0.68%) and G65 (1.93 +/- 0.39%) compared with G25 (1.40 +/- 0.30%; P < 0.05). There was no significant correlation between gait instability and energy cost of walking at preferred walking speed. These findings demonstrated greater energy expenditure in healthy elderly subjects while walking and increased gait instability. However, no relationship was noted between these two variables. The increase in energy cost is probably multifactorial, and our results suggest that gait instability is probably not the main contributing factor in this population. We thus concluded that other mechanisms, such as the energy expenditure associated with walking movements and related to mechanical work, or neuromuscular factors, are more likely involved in the higher cost of walking in elderly people.     

The effect of light levels on daily patterns of chlorophyll fluorescence and organic acid accumulation in the tropical CAM treeClusia hilariana

Sandy plains are characteristic of the coastal region of Brazil. We investigated the diel patterns of changes in organic acid levels, leaf conductance and chlorophylla fluorescence for sun-exposed and shaded plants ofClusia hilariana, one of the dominant woody species in the sandy coastal plains of northern Rio de Janeiro state. Both exposed and shaded plants showed a typical CAM pattern with considerable diel oscillations in organic acid levels. The degradation of both malic and citric acids during the midday stomatal closure period could lead to potential CO₂ fixation rates of 28 mol m^-2 s^-1 in exposed leaves. Moreover, exposed leaves exhibited large increases in total non-photochemical quenching (q_N) accompanied by a substantial decrease in effective quantum yield during the course of the day. However, these potential high rates of CO₂ fixation and the increases inqn of exposed plants were not enough to maintain the primary electron acceptor of photosystem II (q_A) in a low reduction state, similar to that of shaded plants. As a result, there was a moderate increase in the reduction state of q_A throughout the day. Most of the decline in photochemical efficiency of exposed leaves ofC. hilariana was reversible, as evidenced by the high levels of pre-dawn potential quantum yields (F_v/F_m) and their rapid recovery after sunset. However, the depletion of the organic acid pool in the afternoon resulted in an accentuated subsequent drop in F_v/F_m, suggesting that prolonged periods of water stress accompanied by high irradiance levels may expose plants ofC. hilariana in unprotected habitats to the danger of photoinhibition.     

Cyclodextrins enhance the aerobic degradation and dechlorination of low-chlorinated biphenyls

Summary The aerobic dechlorination of 4-chlorobiphenyl and of Aroclor 1221 by Pseudomonas sp. CPE1 strain was enhanced by the presence of hydroxypropyl--cyclodextrin in the medium. The best dechlorination results were obtained when 4-chlorobiphenyl or Aroclor 1221 and the cyclodextrin were used at the molar ratios 1:1 and 1:1.5. This agent can be adopted to enhance the efficiency of PCB degradation tests.