A Starch Deficient Mutant of Arabidopsis thaliana with Low ADPglucose Pyrophosphorylase Activity Lacks One of the Two Subunits of the Enzyme

A starch deficient mutant of Arabidopsis thaliana (L.) Heynh. has been isolated in which leaf extracts contain only about 5% as much activity of ADPglucose pyrophosphorylase (EC 2.7.7.27) as the wild type. A single, nuclear mutation at a previously undescribed locus designated adg2 is responsible for the mutant phenotype. Although the mutant contained only 5% as much ADPglucose pyrophosphorylase activity as the wild type, it accumulated 40% as much starch when grown in a 12 hour photoperiod. The mutant also contained about 40% as much starch as the wild type when grown in continuous light, suggesting that the rate of synthesis regulates its steady state accumulation. Immunological analysis of leaf extracts using antibodies against the spinach 54 and 51 kilodalton (kD) ADPglucose pyrophosphorylase subunits indicated that the mutant is deficient in a cross-reactive 54 kD polypeptide and has only about 4% as much as the wild type of a cross-reactive 51 kD polypeptide. This result and genetic studies suggested that adg2 is a structural gene which codes for the 54 kD polypeptide, and provides the first functional evidence that the 54 kD polypeptide is a required component of the native ADPglucose pyrophosphorylase enzyme.     

Characterization of an HSP70 Cognate Gene Family in Arabidopsis

Analysis of the polypeptide composition of extracts from heat-shocked leaves of Arabidopsis indicated the presence of at least 12 HSP70-related polypeptides, most of which were constitutively expressed. In vitro translation of mRNA from heat-shocked and control leaves indicated that the amount of mRNA encoding four HSP70 polypeptides was increased strongly by heat-shock. Three Arabidopsis genes which exhibit homology to a Drosophila HSP70 gene were cloned. Two of the three genes are arranged in direct orientation approximately 1.5 kilobases apart. The third gene is not closely linked to the other two. Nucleotide sequence analysis of the 5′ regions of the two linked genes revealed that both contain a TATA box, the CAAT motif, and several short sequences which are homologous to the Drosophila heat-shock consensus sequence. The deduced partial amino acid sequence of the open reading frames were 79 and 72% homologous to the corresponding regions of the Drosophila HSP70-cognate and HSP70 sequences, respectively. As with the two maize HSP70 genes which have been characterized, and the Drosophila HSP70-cognate genes, the Arabidopsis genes contained a putative intron in the codon specifying amino acid 72. Analysis of mRNA levels with gene-specific oligonucleotide probes indicated that two of the genes were not expressed or were expressed at very low levels in leaves during normal growth or after heat-shock, whereas the other gene was constitutively expressed. By analogy with the results of similar studies of other organisms, it appears that the three cloned genes are members of a small family which are most closely related to the HSP70-cognate genes found in other species.     

Changes in ascorbic acid content and ascorbate peroxidase activity during the development of Acetabularia mediterranea

We cloned ras-related sequences from goldfish genomic libraries constructed as recombinants using the lambda phage. Restriction enzyme mapping of the clones obtained revealed three kinds of ras-related sequences among approximately 350,000 genomic clones. One of these clones was partially sequenced. Comparison with the nucleotide sequences of mammalian ras genes showed that the determined sequences covered the predicted amino acid coding regions and parts of the intervening regions. The predicted amino acid sequences of the cloned ras-related goldfish gene suggested that the coding region is localized separately in DNA, and that its exon-intron boundaries are exactly the same as those of corresponding mammalian genes. The nucleotide and amino acid sequences of the goldfish ras-related gene may have extensive homologies to mammalian p 21 protein. Among the three mammalian ras proteins, the predicted amino acid sequence of the sequenced ras-related goldfish clone is most closely homologous (96%) to the Kirsten ras protein. Differences in the predicted amino acid sequence were greatest in the sequence predicted from the fourth exon; fewer differences were found in the sequence from the third exon, and only slight or no differences were found in the sequence predicted for the first and second exons. The 12th and 61st amino acids from the N-terminal of the protein, which are thought to be critical positions for GTP binding and catalysis, are both conserved in the goldfish protein.(ABSTRACT TRUNCATED AT 250 WORDS)     

Protection against Leishmania major in BALB/c mice by adoptive transfer of a T cell clone recognizing a low molecular weight antigen released by promastigotes

We have shown previously that BALB/c mice can be protected against a fatal infection with Leishmania major by adoptive transfer of a T cell line recognizing a protective soluble fraction (fraction 9) of promastigotes. We now describe the isolation and characterization of a T cell clone (9.1-2) that also transfers protective immunity against Leishmania. After Ag or mitogen stimulation, this clone secrets IL-2 and IFN-gamma, but not IL-4 or IL-5. The clone preferentially recognizes L. major fraction 9, and in addition, soluble Ag from Leishmania donovani, Leishmania amazonensis, and Leishmania braziliensis, but not from the related flagellates, Trypanosoma cruzi or Crithidia fasciculata. Besides being contained in fraction 9, the stimulatory Ag is also released from the parasite, because concentrated promastigote culture supernatants induced IFN-gamma production by 9.1-2. By means of T cell immunoblotting, we determined that 9.1-2 recognized a protein with a relative m.w. between 8,000 and 12,000, and within this region is a predominant protein contained in fraction 9 of approximately 10,000 m.w. These data identify a new candidate Ag for immunization against protozoa belonging to the genus Leishmania.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Purification and Characterization of the Enzymes of Fructan Biosynthesis in Tubers of Helianthus tuberosus Colombia (II. Purification of Sucrose:Sucrose 1-Fructosyltransferase and Reconstitution of Fructan Synthesis in Vitro with Purified Sucrose:Sucrose 1-Fructosyltransferase and Fructan:Fructan 1-Fructosyltransferase)

Sucrose:sucrose 1-fructosyltransferase (1-SST), an enzyme involved in fructan biosynthesis, was purified to homogeneity from tubers of Helianthus tuberosus that were harvested in the accumulation phase. Gel filtration under native conditions predicted a molecular mass of about 67 kD. Electrophoresis or gel filtration under denaturing conditions yielded a 27- and a 55-kD fragment. 1-SST preferentially catalyzed the conversion of sucrose into the trisaccharide 1-kestose (GF2). Other reactions catalyzed by 1-SST at a lower rate were self-transfructosylations with GF2 and 1,1-nystose (GF3) as substrates yielding GF3 and 1,1,1-fructosylnystose, respectively, as products. 1-SST also catalyzed the removal of the terminal fructosyl unit from both GF2 and GF3, which resulted in the release of sucrose and GF2, respectively, and free Fru. The purified enzyme did not display [beta]-fructosidase activity. An enzyme mixture of purified 1-SST and fructan:fructan 1-fructosyltransferase, both isolated from tubers, was able to synthesize fructans up to a degree of polymerization of at least 13 with sucrose as a sole substrate.     

Maternal cell contamination in amniotic fluid samples as a consequence of the sampling technique

Maternal cell contamination in amniotic fluid samples is easily detected by in situ hybridization if the karyotype of the fetus differs from the karyotype of the mother. One out of two amniotic fluid samples appears to contain more than 20% maternal cells. Bloody samples often contain even more than 50% maternal cells. Maternal cells can also be identified on the basis of their nuclear morphology. Maternal cell contamination is regularly observed in pregnancies with an anterior placenta, whereas it is rare in posterior placenta pregnancies. The maternal cells are therefore thought to be artificially introduced into the amniotic fluid sample, as a result of placental bleeding during amniocentesis. The implications of maternal cell contamination for prenatal diagnosis using uncultured amniotic fluid samples are discussed.     

DNA binding factor GT-2 from Arabidopsis

Complementary DNA clones encoding a DNA-binding factor have been obtained from Arabidopsis by DNA hybridization with a GT-2 factor cDNA clone from rice. The GT-2 gene appears to be present as a single copy in the Arabidopsis genome and is transcribed as a 2.1 kb mRNA which is not light-regulated. The longest open reading frame in the sequenced clones predicts a protein of 65 kDa, beginning with the first in-frame methionine. The protein contains basic, acidic, and proline/glutamine-rich motifs and has significant amino acid sequence homology to the rice GT-2 factor, including three regions of 50–75 amino acids each of greater than 60% identity. Two of these regions are predicted to form similar trihelix structures postulated to be involved in selective binding to specific variations of a GT-box motif DNA sequence found in the promoter regions of several plant genes. Except for weak similarity to a tobacco GT-box binding factor, GT-1a/B2F, Arabidopsis GT-2 has no similarity to other sequences in the databases. DNA-binding studies show that Arabidopsis GT-2 has binding characteristics similar to those of the rice GT-2 factor, but dissimilar to those of the tobacco GT-1a/B2F factor. The data indicate that a DNA-binding factor containing domains of similar structure and target-sequence specificity has been conserved between monocots and dicots.