Pretubulysin: a new option for the treatment of metastatic cancer

Tubulin-binding agents such as taxol, vincristine or vinblastine are well-established drugs in clinical treatment of metastatic cancer. However, because of their highly complex chemical structures, the synthesis and hence the supply issues are still quite challenging. Here we set on stage pretubulysin, a chemically accessible precursor of tubulysin that was identified as a potent microtubule-binding agent produced by myxobacteria. Although much simpler in chemical structure, pretubulysin abrogates proliferation and long-term survival as well as anchorage-independent growth, and also induces anoikis and apoptosis in invasive tumor cells equally potent to tubulysin. Moreover, pretubulysin posseses in vivo efficacy shown in a chicken chorioallantoic membrane (CAM) model with T24 bladder tumor cells, in a mouse xenograft model using MDA-MB-231 mammary cancer cells and finally in a model of lung metastasis induced by 4T1 mouse breast cancer cells. Pretubulysin induces cell death via the intrinsic apoptosis pathway by abrogating the expression of pivotal antiapoptotic proteins, namely Mcl-1 and Bcl-x_L, and shows distinct chemosensitizing properties in combination with TRAIL in two- and three-dimensional cell culture models. Unraveling the underlying signaling pathways provides novel information: pretubulysin induces proteasomal degradation of Mcl-1 by activation of mitogen-activated protein kinase (especially JNK (c-Jun N-terminal kinase)) and phosphorylation of Mcl-1, which is then targeted by the SCF^Fbw7 E3 ubiquitin ligase complex for ubiquitination and degradation. In sum, we designate the microtubule-destabilizing compound pretubulysin as a highly promising novel agent for mono treatment and combinatory treatment of invasive cancer.     

Biliverdin IX delta and neobiliverdin IX delta, isolated from the ovaries of the marine snail, Turbo cornutus

The ovaries of the marine snail Turbo cornutus contain a number of pigments. So far, the presence of carotenoids and a chromoprotein with a bile pigment, called turboverdin (= 3(2)-hydroxy-mesobiliverdin IX alpha), as its prosthetic group are known. The present work describes the isolation and structure elucidation of two further bile pigments, biliverdin IX delta and neobiliverdin IX delta. This is the first report of naturally occurring bile pigments with IX delta structure.     

Uptake and metabolism of clomazone in tolerant-soybean and susceptible-cotton photomixotrophic cell suspension cultures

Studies were conducted to determine the uptake and metabolism of the pigment synthesis inhibiting herbicide clomazone in tolerant-soybean (Glycine max [L.] Merr. cv Corsoy) and susceptible-cotton (Gossypium hirsutum [L.] cv Stoneville 825) photomixotrophic cell suspensions. Soybean and cotton on a whole plant level are tolerant and susceptible to clomazone, respectively. Preliminary studies indicated that I₅₀ values for growth, chlorophyll (Chl), β-carotene, and lutein were, respectively, >22, 14, 19, and 23 times greater for the soybean cell line (SB-M) 8 days after treatment (DAT) compared to the cotton cell line (COT-M) 16 DAT. Differences in [¹⁴C]clomazone uptake cannot account for selectivity since there were significantly greater levels of clomazone absorbed by the SB-M cells compared to the COT-M cells for each treatment. The percentage of absorbed clomazone converted to more polar metabolite(s) was significantly greater by the SB-M cells relative to COT-M cells at 6 and 24 hours after treatment, however, only small differences existed between the cell lines by 48 hours after treatment. Nearly identical levels of parental clomazone was recovered from both cell lines for all treatments. A pooled metabolite fraction isolated from SB-M cells had no effect on the leaf pigment content of susceptible velvetleaf (Abutilon theophrasti Medic.) or soybean seedlings. Conversely, a pooled metabolite fraction from COT-M cells reduced the leaf Chl content of velvetleaf. Soybean tolerance to clomazone appears to be due to differential metabolism (bioactivation) and/or differences at the site of action.     

Site of clomazone action in tolerant-soybean and susceptible-cotton photomixotrophic cell suspension cultures

Studies were conducted to determine the herbicidal site of clomazone action in tolerant-soybean (Glycine max [L.] Merr. cv Corsoy) (SB-M) and susceptible-cotton (Gossypium hirsutum [L.] cv Stoneville 825) (COT-M) photomixotrophic cell suspension cultures. Although a 10 micromolar clomazone treatment did not significantly reduce the terpene or mixed terpenoid content (microgram per gram fresh weight) of the SB-M cell line, there was over a 70% reduction in the chlorophyll (Chl), carotenoid (CAR), and plastoquinone (PQ) content of the COT-M cell line. The tocopherol (TOC) content was reduced only 35.6%. Reductions in the levels of Chl, CAR, TOC, and PQ indicate that the site of clomazone action in COT-M cells is prior to geranylgeranyl pyrophosphate (GGPP). The clomazone treatment did not significantly reduce the flow of [¹⁴C]mevalonate ([¹⁴C]MEV) (nanocuries per gram fresh weight) into CAR and the three mixed terpenoid compounds of SB-M cells. Conversely, [¹⁴C]MEV incorporation into CAR and the terpene moieties of Chl, PQ, and TOC in COT-M cells was reduced at least 73%, indicating that the site of clomazone action must be after MEV. Sequestration of clomazone away from the chloroplast cannot account for soybean tolerance to clomazone since chloroplasts isolated from both cell lines incubated with [¹⁴C]clomazone contained a similar amount of radioactivity (disintegrations per minute per microgram of Chl). The possible site(s) of clomazone inhibition include mevalonate kinase, phosphomevalonate kinase, pyrophosphomevalonate decarboxylase, isopentenyl pyrophosphate isomerase, and/or a prenyl transferase.     

Purification and properties of recombinant β-glucosidase of the hyperthermophilic bacterium Thermotoga maritima

A -glucosidase of the hyperthermophilic bacterium Thermotoga maritima has been purified from a recombinant Escherichia coli clone expressing the corresponding gene. The enzyme was found to be a dimer with an apparent molecular mass of approximately 95 kDa as determined by size exclusion chromatography. It was composed of two apparently identical subunits of about 47 kDa (determined by sodium dodecyl sulphate-polyacrylamide gel electrophoresis). The enzyme had a bbroadsubstrate specificity and attacked -glucoside, -galactoside, -fucoside, and, to a very small extent, also -xyloside substrates. -Glycosidic bonds were not hydrolysed. Kinetic measurement of the hydrolysis of o-nitrophenyl--d-glucopyranoside (oNPGlc) and o-nitrophenyl--d-galactopyranoside (oNPGal) in the concentration ranges 0.05–20 mm and 0.1–10 mm, respectively, at 75°C resulted in non-linear Lineweaver-Burk and Eadie-Hofstee 3lots whereas cellobiose and lactose did not induce this type of effect. Lactose caused substrate inhibition above 350 mm. The enzyme was optimally active at about pH 6.1. The T. maritima -glucosidase represents the most thermostable -glucosidase described to date. In 50 mm sodium phosphate buffer, pH 6.2, at an enzyme concentration of 50 g/ml, the pure enzyme without additives retained more than 60% of its initial activity after a 6-h incubation at 95°C. Correspondence to: W. Liebl     

(Beta alpha)8-barrel proteins of tryptophan biosynthesis in the hyperthermophile Thermotoga maritima.

To better understand the evolution of a key metabolic pathway, we have sequenced the trpCFBA gene cluster of the hyperthermophilic bacterium Thermotoga maritima. The genes were cloned by complementation in vivo of trp deletion strains of Escherichia coli. The new sequences, together with earlier findings, establish that the trp operon of T.maritima has the order trpE(G.D)CFBA, which might represent the ancestral organization of the tryptophan operon. Heterologous expression of the trp(G.D) and trpC genes in E.coli and N-terminal sequencing of their polypeptide products showed that their translation is initiated at the rate start codons TTG and ATC, respectively. Consequently, the N-terminus of the trp(G.D) fusion protein is 43 residues shorter than previously postulated. Amino acid composition and sequence analyses of the protein products of T.maritima trpC (indoleglycerol phosphate synthase), trpF (phosphoribosyl anthranilate isomerase) and trpA (alpha-subunit of tryptophan synthase) suggest that these thermostable (beta alpha)8-barrel proteins may be stabilized by additional salt bridges, compared with the mesostable forms. Another notable feature is the predicted lack of the N-terminal helix alpha 0 in the alpha-subunit of tryptophan synthase.     

High efficiency transient and stable transformation by optimized DNA microinjection into Nicotiana tabacum protoplasts

An efficient system has been established that allows well controlledDNA microinjection into tobacco (Nicotiana tabacum) mesophyllprotoplasts with partially regenerated cell walls and subsequentanalysis of transient as well as stable expression of injectedreporter genes in particular targeted cells or derived clones.The system represents an effective tool to study parametersimportant for the successful transformation of plant cells bymicroinjection and other techniques. Protoplasts were immobilizedin a very thin layer of medium solidified with agarose or alginate.DNA microinjection was routinely monitored by coinjecting FITC-dextranand aimed at the cytoplasm of target cells. The injection procedurewas optimized for efficient delivery of injection solution intothis compartment. Cells were found to be at the optimal stagefor microinjection about 24 h after immobilization in solidmedium. Embedded cells could be kept at this stage for up to4 d by incubating them at 4 C in the dark. Within 1 h successfuldelivery of injection, solution was routinely possible into20–40 cells. Following cytoplasmic coinjection of FITC-dextran and pSHI913,a plasmid containing the neo (neomycin phosphotransferase II)gene, stably transformed, paromomycin-resistant clones couldbe recovered through selection. Transgenic tobacco lines havebeen established from such clones. Injection solutions containingpSHI913 at a concentration of either 50 µg ml^–1or 1 mg ml^–1 have been tested. With 1 mg ml^–1 plasmidDNA the percentage of resistant clones per successfully injectedcell was determined to be about 3.5 times higher. Incubationof embedded protoplasts at 4C before microinjection was foundto reduce the percentage of resistant clones obtained per injectedcell Protoplasts were immobilized above a grid pattern and the locationof injected cells was recorded by Polaroid photography. Thefate of particular targeted cells could be observed. Isolationand individual culture of clones derived from injected cellswas possible. Following cytoplasmic coinjection of FITC-dextranand 1 mg ml^–1 plasmid DNA on average about 20% of thetargeted cells developed into microcalli and roughly 50% ofthese calli were stably transformed. Transient expression ofthe firefly luciferase gene (Luc) was nondestructively analysed24 h after injection of pAMLuc. Approximately 50% of the injectedcells that were alive at this time point expressed the Luc genetransiently. Apparently, stable integration of the injectedgenes occurred in essentially all transiently expressing cellsthat developed into clones. Key words: DNA microinjection, firefly luciferase, FITCdextran, Nicotiana tabacum, protoplast transformation     

Identification of a novel cellulose-binding domain the multidomain 120 kDa xylanase XynA of the hyperthermophilic bacterium Thermotoga maritima

A segment of Thermotoga maritima strain MSB8 chromosomal DNA was isolated which encodes an endo-1,4-β-D-xylanase, and the nucleotide sequence of the xylanase gene, designated xynA, was determined. With a half-life of about 40 min at 90°C at the optimal pH of 6.2, purified recombinant XynA is one of the most thermostable xylanases known. XynA is a 1059-amino-acid (?120 kDa) modular enzyme composed of an N-terminal signal peptide and five domains, in the order A1-A2-B-C1-C2. By comparison with other xylanases of family 10 of glycosyl hydrolases, the central ?340-amino-acid part (domain B) of XynA represents the catalytic domain. The N terminal ?150-amino-acid repeated domains (A1-A2) have no significant similarity to the C-terminal ?170-amino-acid repeated domains (C1-C2). Cellulose-binding studies with truncated XynA derivatives and hybrid proteins indicated that the C-terminal repeated domains mediate the binding of XynA to microcrystalline cellulose and that C2 alone can also promote cellulose binding. C1 and C2 did not share amino acid sequence similarity with any other known cellulose-binding domain (CBD) and thus are CBDS of a novel type. Structurally related protein segments which are probably also CBDs were found in other multi-domain xylanolytic enzymes. Deletion of the N-terminal repeated domains or of all the non-catalytic domains resulted In substantially reduced tbermostability while a truncated xylanase derivative lacking the C-terminal tandem repeat was as thermostable as the full-length enzyme. It is argued that the multidomain organization of some enzymes may be one of the strategies adopted by thermophiles to protect their proteins against thermal denaturation.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Straw utilization for biofuel production: A consequential assessment of greenhouse gas emissions from bioethanol and biomethane provision with a focus on the time dependency of emissions

The shift from straw incorporation to biofuel production entails emissions from production, changes in soil organic carbon (SOC) and through the provision of (co‐)products and entailed displacement effects. This paper analyses changes in greenhouse gas (GHG) emissions arising from the shift from straw incorporation to biomethane and bioethanol production. The biomethane concept comprises comminution, anaerobic digestion and amine washing. It additionally provides an organic fertilizer. Bioethanol production comprises energetic use of lignin, steam explosion, enzymatic hydrolysis and co‐fermentation. Additionally, feed is provided. A detailed consequential GHG balance with in‐depth focus on the time dependency of emissions is conducted: (a) the change in the atmospheric load of emissions arising from the change in the temporal occurrence of emissions comparing two steady states (before the shift and once a new steady state has established); and (b) the annual change in overall emissions over time starting from the shift are assessed. The shift from straw incorporation to biomethane production results in net changes in GHG emissions of (a) ?979 (?436 to ?1,654) and (b) ?955 (?220 to ?1,623) kg CO₂‐eq. per t_{dry matter} straw converted to biomethane (minimum and maximum). The shift to bioethanol production results in net changes of (a) ?409 (?107 to ?610) and (b) ?361 (57 to ?603) kg CO₂‐eq. per t_{dry matter} straw converted to bioethanol. If the atmospheric load of emissions arising from different timing of emissions is neglected in case (a), the change in GHG emissions differs by up to 54%. Case (b) reveals carbon payback times of 0 (0–49) and 19 (1–100) years in case of biomethane and bioethanol production, respectively. These results demonstrate that the detailed inclusion of temporal aspects into GHG balances is required to get a comprehensive understanding of changes in GHG emissions induced by the introduction of advanced biofuels from agricultural residues.