Utilization of siderophores by Candida albicans

Candida albicans secretes both hydroxamate and phenolate-type siderophores when grown under iron-restricted conditions. The inhibition of candidal growth by iron limitation was reversed by the addition of supplemental hydroxamate on phenolate siderophores. Both siderophores produced equal stimulation of growth suggesting that C. albicans could utilize both siderophores with equal efficiency. Addition of heterologous siderophores from both bacteria and fungi also supported growth of the yeast in a deferrated medium. These results suggest that C. albicans has an iron-uptake mechanism which enables it to obtain iron by utilizing candidal and non-candidal siderophores.     

Successful phytoremediation of crude-oil contaminated soil at an oil exploration and production company by plants-bacterial synergism

Phytoremediation is a promising approach for the cleanup of soil contaminated with petroleum hydrocarbons. This study aimed to develop plant-bacterial synergism for the successful remediation of crude oil-contaminated soil. A consortia of three endophytic bacteria was augmented to two grasses, Leptochloa fusca and Brachiaria mutica, grown in oil-contaminated soil (46.8 g oil kg^?1 soil) in the vicinity of an oil exploration and production company. Endophytes augmentation improved plant growth, crude oil degradation, and soil health. Maximum oil degradation (80%) was achieved with B. mutica plants augmented with the endophytes and it was significantly (P < 0.05) higher than the use of plants or bacteria individually. Moreover, endophytes showed more persistence, the abundance and expression of alkB gene in the rhizosphere as well as in the endosphere of the tested plants than in unvegetated soil. A positive relationship (r = 0.70) observed between gene expression and crude oil reduction indicates that catabolic gene expression is important for hydrocarbon mineralization. This investigation showed that the use of endophytes with appropriate plant is an effective strategy for the cleanup of oil-contaminated soil under field conditions.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Erratum to: Synthesis and Anticancer Activity of Functionalized Thieno[2,3-d]pyrimidine Compounds and Their Triazinyl and Tetrazinyl Derivatives

Russian Journal of Bioorganic Chemistry - erratum     

Association of polymorphisms in genes involved in enamel formation,taste preference and immune response with early childhood caries in Saudi pre-school children

Dental caries is primarily elicited by modifiable factors such as inadequate oral hygiene, poor dietary practices and deficient fluoride exposure. However, there is a growing body of evidence suggesting the profound influence of genetic factors in dental caries susceptibility. The present study aimed to evaluate the association between single nucleotide polymorphisms (SNPs) in ENAM (rs12640848), MMP20 (rs1784418), TAS2R38 (rs713598), and LTF (rs4547741) genes and early childhood caries (ECC) in Saudi preschool children. This case-control study enrolled 360 Saudi preschool children (262 with ECC and 98 caries-free). Data on environmental factors were collected through a questionnaire. However, caries experience and oral hygiene data were obtained during clinical examination. Buccal swab samples were collected for DNA extraction and SNPs were genotyped using PCR and DNA sequencing. Children with ECC were compared to caries free children (control), then they were categorized into two categories based on ECC severity as follows; non-severe ECC (NS-ECC), and severe-ECC (S-ECC). Association between the SNPs, ECC, NS-ECC, and S-ECC was reported as an odds ratio (OR) with a 95% confidence interval (CI). The majority of the children (72.8%) exhibited ECC (31.7% NS-ECC and 41.1% S-ECC) with mean dmft of 4.20 ± 4.05. Multivariate analyses of environmental factors showed that nocturnal feeding was a risk factor for ECC (P = 0.008). Poor oral hygiene was also a risk factor for both NS-ECC and S-ECC (ECC: P < 0.0001, NS-ECC: P = 0.032 and S-ECC: P < 0.0001). Univariate analysis showed that the AG genotype of rs1784418 of MMP20 gene was protective against ECC (OR = 0.532; 95% CI = 0.316–0.897, P = 0.018) and against NS-ECC (OR = 0.436; 95% CI = 0.238–0.798, P = 0.007). When environmental risk factors for ECC were included as covariates during multivariate analysis, AG variant in rs1784418 of MMP20 gene remained less frequent in NS-ECC cases compared to controls with borderline significance (OR = 0.542; 95% CI = 0.285–1.033, P = 0.063). Our findings concluded that MMP20 rs1784418 SNP might be associated with protection against ECC in Saudi preschool children.     

Extracellular biosynthesis,characterization, optimization of silver nanoparticles (AgNPs) using Bacillus mojavensis BTCB15 and its antimicrobial activity against multidrug resistant pathogens

Abstract

Biosynthesis of metal nanoparticles is an area of interest among researchers because of its eco-friendly approach. Current study focuses at biosynthesis of silver nanoparticles (AgNPs) and optimization of physico-chemical conditions to obtain mono-dispersed and stable AgNPs having antimicrobial activity. Initially Bacillus mojavensis BTCB15 produced silver nanoparticles (AgNPs) of 105?nm. Silver nanoparticles (AgNPs) were characterized by particle size analyzer, UV-Vis Spectroscopy, Fourier transforms infrared spectroscopy (FTIR), Atomic force microscopy (AFM), and X-ray diffraction (XRD). Whereas, under optimal conditions of temperature 55?°C, pH 8, addition of surfactant Tween 20, and metal ion K₂SO₄, about 104% size reduction was achieved with average size of 2.3nm. Molecular characterization revealed 98% sequence homology with Bacillus mojavensis. AgNPs exhibited antibacterial activity at concentrations ranging from 0.5 to 2.5?µg/µl against Escherichia coli BTCB03, Klebsiella pneumonia BTCB04, Acinetobacter sp. BTCB05, and Pseudomonas aeruginosa BTCB01 but none against Staphylococcus aureus BTCB02. Highest antibacterial activity was observed at 0.27?µg/µl and lowest at 0.05?µg/µl of AgNPs indicated by zone of inhibition. Conclusively, under optimum conditions, Bacillus mojavensis BTCB15 was able to produce AgNPs of 2.3?nm size and had antibacterial activity against multi drug resistant pathogens.     

In vitro cytotoxic,antibacterial, antifungal and urease inhibitory activities of some N4- substituted isatin-3-thiosemicarbazones

A series of 15 previously reported N⁴-substituted isatin-3-thiosemicarbazones 3a-o has been screened for cytotoxic, antibacterial, antifungal and urease inhibitory activities. Compounds 3b, 3e and 3n proved to be active in cytotoxicity assay; 3e exhibited a high degree of cytotoxic activity (LD₅₀ = 1.10 × 10^{? 5} M). Compound 3h exhibited significant antibacterial activity against B. subtilis, whereas compounds 3a, 3k and 3l displayed significant antifungal activity against one or more fungal strains i.e. T. longifusus, A. flavus and M. canis. In human urease enzyme inhibition assay, compounds 3g, 3k and 3m proved to be the most potent inhibitors, exhibiting relatively pronounced inhibition of the enzyme. These compounds, being non-toxic, could be potential candidates for orally effective therapeutic agents to treat certain clinical conditions induced by bacterial ureases like H. pylori urease. This study presents the first example of inhibition of urease by isatin-thiosemicarbazones and as such provides a solid basis for further research on such compounds to develop more potent inhibitors.     

Studies on the regioselectivity and kinetics of the action of trypsin on proinsulin and its derivatives using mass spectrometry

Human M-proinsulin was cleaved by trypsin at the R³¹R³²–E³³ and K⁶⁴R⁶⁵–G⁶⁶ bonds (B/C and C/A junctions), showing the same cleavage specificity as exhibited by prohormone convertases 1 and 2 respectively. Buffalo/bovine M-proinsulin was also cleaved by trypsin at the K⁵⁹R⁶⁰–G⁶¹ bond but at the B/C junction cleavage occurred at the R³¹R³²–E³³ as well as the R³¹–R³²E³³ bond. Thus, the human isoform in the native state, with a 31 residue connecting C-peptide, seems to have a unique structure around the B/C and C/A junctions and cleavage at these sites is predominantly governed by the structure of the proinsulin itself. In the case of both the proinsulin species the cleavage at the B/C junction was preferred (65%) over that at the C/A junction (35%) supporting the earlier suggestion of the presence of some form of secondary structure at the C/A junction. Proinsulin and its derivatives, as natural substrates for trypsin, were used and mass spectrometric analysis showed that the k_cat./K_m values for the cleavage were most favourable for the scission of the bonds at the two junctions (1.02 ± 0.08 × 10⁵ s^− 1 M^− 1) and the cleavage of the K²⁹–T³⁰ bond of M-insulin-RR (1.3 ± 0.07 × 10⁵ s^− 1 M^− 1). However, the K²⁹–T³⁰ bond in M-insulin, insulin as well as M-proinsulin was shielded from attack by trypsin (k_cat./K_m values around 1000 s^− 1 M^− 1). Hence, as the biosynthetic path follows the sequence; proinsulin → insulin-RR → insulin, the K²⁹–T³⁰ bond becomes shielded, exposed then shielded again respectively.