Stabilization of Z-RNA by chemical bromination and its recognition by anti-Z-DNA antibodies

Limited chemical bromination of poly[r(C-G)] (32% br8G, 26% br5C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. More extensive bromination of poly[r(C-G)] (greater than 49% br8G, 43% br5C) results in stabilization of a form of RNA having a Z-DNA-like (ZD) CD spectrum in low-salt, pH 7.0-7.5 buffers. Raising the ionic strength to 6 M NaBr or NaClO4 results in a transition in Br-poly[r(C-G)] to a Z-RNA (ZR) conformation as judged by CD spectroscopy. At lower ionic strength Z-DNA-like (ZD) and A-RNA conformations are also present. 1H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37 degrees C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', and CH1' resonances in both the A- and Z-forms. GH8----GH1' NOEs demonstrate the presence of both A- and Z-form GH8 resonances in slow exchange on the NMR time scale. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 degrees C. Comparison with the spectrum of Z-DNA indicates that there may be different glycosidic torsion angles in Z-RNA and Z-DNA [Tinoco, I., Jr., Cruz, P., Davis, P., Hall, K., Hardin, C. C., Mathies, R. A., Puglisi, J. D., Trulson, M. O., Johnson, W. C., & Neilson, T. (1986) in Structure and Dynamics of RNA, pp 55-68, Plenum, New York].(ABSTRACT TRUNCATED AT 250 WORDS)     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Role of NAD+ and ADP-Ribosylation in the Maintenance of the Golgi Structure

We have investigated the role of the ADP- ribosylation induced by brefeldin A (BFA) in the mechanisms controlling the architecture of the Golgi complex. BFA causes the rapid disassembly of this organelle into a network of tubules, prevents the association of coatomer and other proteins to Golgi membranes, and stimulates the ADP-ribosylation of two cytosolic proteins of 38 and 50 kD (GAPDH and BARS-50; De Matteis, M.A., M. DiGirolamo, A. Colanzi, M. Pallas, G. Di Tullio, L.J. McDonald, J. Moss, G. Santini, S. Bannykh, D. Corda, and A. Luini. 1994. Proc. Natl. Acad. Sci. USA. 91:1114–1118; Di Girolamo, M., M.G. Silletta, M.A. De Matteis, A. Braca, A. Colanzi, D. Pawlak, M.M. Rasenick, A. Luini, and D. Corda. 1995. Proc. Natl. Acad. Sci. USA. 92:7065–7069). To study the role of ADP-ribosylation, this reaction was inhibited by depletion of NAD⁺ (the ADP-ribose donor) or by using selective pharmacological blockers in permeabilized cells. In NAD⁺-depleted cells and in the presence of dialized cytosol, BFA detached coat proteins from Golgi membranes with normal potency but failed to alter the organelle's structure. Readdition of NAD⁺ triggered Golgi disassembly by BFA. This effect of NAD⁺ was mimicked by the use of pre–ADP- ribosylated cytosol. The further addition of extracts enriched in native BARS-50 abolished the ability of ADP-ribosylated cytosol to support the effect of BFA. Pharmacological blockers of the BFA-dependent ADP-ribosylation (Weigert, R., A. Colanzi, A. Mironov, R. Buccione, C. Cericola, M.G. Sciulli, G. Santini, S. Flati, A. Fusella, J. Donaldson, M. DiGirolamo, D. Corda, M.A. De Matteis, and A. Luini. 1997. J. Biol. Chem. 272:14200–14207) prevented Golgi disassembly by BFA in permeabilized cells. These inhibitors became inactive in the presence of pre–ADP-ribosylated cytosol, and their activity was rescued by supplementing the cytosol with a native BARS-50–enriched fraction. These results indicate that ADP-ribosylation plays a role in the Golgi disassembling activity of BFA, and suggest that the ADP-ribosylated substrates are components of the machinery controlling the structure of the Golgi apparatus.     

Allelism of IMP1 and GAL2 genes of Saccharomyces cerevisiae.

Cloning and characterization of the previously described Saccharomyces cerevisiae IMP1 gene, which was assumed to be a nuclear determinant involved in the nucleomitochondrial control of the utilization of galactose, demonstrate allelism to the GAL2 gene. Galactose metabolism does not necessarily involve the induction of the specific transport system coded by GAL2/IMP1, because a null mutant takes up galactose and grows on it. Data on galactose uptake are presented, and the dependence on ATP for constitutive and inducible galactose transport is discussed. These results can account for the inability of imp1/gal2 mutants to grow on galactose in a respiration-deficient background. Under these conditions, uptake was affected at the functional level but not at the biosynthetic level.     

Effect of chloramphenicol,antimycin A and hydroxamate on the morphogenetic development of the dimorphic ascomyceteEndomycopsis capsularis

Mitochondrial protein synthesis, primary (antimycin-sensitive) respiration and secondary (antimycin-insensitive, salicyl-hydroxamate-sensitive) respiration, have been characterized in the dimorphic yeastEndomycopsis capsularis. The inhibition by chloramphenicol (CAP) of the morphogenetic development from the yeast-like form to the mycelial structure in this yeast could represent the intervention in the morphogenetic process of mitochondrial protein synthesis, since chloramphenicol blocks in vivo and in vitro mitochondrial protein synthesis. In fact, other functions such as primary and secondary respiration, do not seem to play a role in the morphogenetic development since their inhibition by antimycin A (AA) or by salicyl-hydroxamic acid (SHAM) does not affect the process. In addition, mitochondrial protein synthesis has been shown to be uninhibited by the two respiratory inhibitors.     

IMP1/imp1: A Gene Involved in the Nucleo-Mitochondrial Control of Galactose Fermentation in SACCHAROMYCES CEREVISIAE

In some strains of Saccharomyces cerevisiae, the induction of enzymes of the Leloir pathway, galactose fermentation and growth on galactose depend on mitochondrial function; mitochondrial dependence is elicited through the recessive allele imp1 of the nuclear gene IMP1. The genetic element IMP1 is not allelic to any of the known GAL genes; IMP1 strains can grow on and ferment galactose in respiratory-deficient (RD) condition or in the presence of the mitochondrial inhibitors ethidium bromide and erythromycin; whereas, imp1 strains can grow on and ferment galactose only in respiratory-sufficient (RS) condition. The imp1 elicited mitochondrial dependence apparently involves regulation of the synthesis of the galactose catabolizing enzymes and synthesis of the galactose specific permease. IMP1 is not the only genetic determinant that elicits an interaction of the mitochondrion and the expression of the Gal system; the GAL3 gene, whose role in galactose utilization is demonstrated by the long-term adaptation phenotype of gal3 RS mutants, gives rise to a noninducible phenotype in RD condition or in the presence of mitochondrial inhibitors.     

Corpus luteum susceptibility to prostaglandin F2α (PGF2α) luteolysis in hysterectomized prepuberal and mature gilts

The susceptibility of induced corpora lutea (CL) of prepuberal gilts and spontaneously formed CL of mature gilts to prostaglandin F_2α (PGF_2α) luteolysis was studied. Prepuberal gilts (120 to 130 days of age) were induced to ovulate with Pregnant Mare Serum Gonadotropin and Human Chorionic Gonadotropin (HCG). The day following HCG was designated as Day 0. Mature gilts which had displayed two or more estrous cycles of 18 to 22 days were used (onset of estrus = Day 0). Gilts were laparotomized on Day 6 to 9, their CL marked with sterile charcoal and totally hysterectomized. On Day 20, gilts were injected IM with either distilled water (DW), 2.5 mg PGF_2α or 5.0 mg PGF_2α. An additional group of prepuberal gilts was injected with 1.25 mg PGF_2α, a dose of PGF_2α equivalent, on a per kilogram body weight basis, to the 2.5 mg PGF_2α dose given to the mature gilts. The percentages of luteal regression on Day 27 to 30 for mature and prepuberal gilts given DW, 2.5 mg PGF_2α and 5.0 mg PGF_2α were 0.0 vs 4.4, 43.5 vs 96.8 and 47.7 vs 91.6, respectively; the percentage of luteal regression for the prepuberal gilts given 1.25 mg PGF_2α was 75.1. These results indicate that induced CL of the prepuberal gilt were more susceptible to PGF_2α luteolysis than spontaneously formed CL of the mature gilt and that pregnancy failure in the prepuberal gilt could be due to increased susceptibility of induced CL to the natural luteolysin.