Mimicking SIV chimpanzee viral evolution toward HIV-1 during cross-species transmission

HIV-1 evolved from SIV during cross-species transmission events, though viral genetic changes are not well understood. Here, we studied the evolution of SIVcpzLB715 into HIV-1 Group M using humanized mice. High viral loads, rapid CD4⁺ T-cell decline, and non-synonymous substitutions were identified throughout the viral genome suggesting viral adaptation.     

Nationwide prevalence of Torque teno sus virus 1 and k2a in pig populations in Japan

Because broad genetic diversity has recently been detected in Torque teno sus viruses (TTSuV1 and TTSuVk2), the viral genome detection method needs to be improved to understand the prevalence of these viruses. Here, we established single PCR-based detection methods for the TTSuV1 and TTSuVk2a genomes with newly designed primer pairs and applied them to investigate the prevalence of TTSuV1 and TTSuVk2a in Japanese pig populations. The results revealed that 98.2% and 81.7% of the pig farms tested positive for the TTSuV1 and TTSuVk2a genomes, respectively, indicating that both TTSuV1 and TTSuVk2a are widespread in Japan.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Exploring the effects of immunity and life history on the dynamics of an endogenous retrovirus

Mammalian DNA is littered with the signatures of past retroviral infections. For example, at least 8% of the human genome can be attributed to endogenous retroviruses (ERVs). We take a single-locus approach to develop a simple susceptible–infected–recovered model to investigate the circumstances under which a disease-causing retrovirus can become incorporated into the host genome and spread through the host population if it were to confer an immunological advantage. In the absence of any fitness benefit provided by the long terminal repeat (LTR), we conclude that signatures of ERVs are likely to go to fixation within a population when the probability of evolving cellular/humoral immunity to a related exogenous version of the virus is extremely small. We extend this model to examine whether changing the speed of the host life history influences the likelihood that an exogenous retrovirus will incorporate and spread to fixation. Our results reveal the parameter space under which incorporation of exogenous retroviruses into a host genome may be beneficial to the host. In our final model, we find that the likelihood of an LTR reaching fixation in a host population is not strongly affected by host life history.     

Structural and dynamics characterization of norovirus protease

Norovirus protease is an essential enzyme for proteolytic maturation of norovirus nonstructural proteins and has been implicated as a potential target for antiviral drug development. Although X‐ray structural studies of the protease give us wealth of structural information including interactions of the protease with its substrate and dimeric overall structure, the role of protein dynamics in the substrate recognition and the biological relevance of the protease dimer remain unclear. Here we determined the solution NMR structure of the 3C‐like protease from Norwalk virus (NV 3CLpro), a prototype strain of norovirus, and analyzed its backbone dynamics and hydrodynamic behavior in solution. ¹⁵N spin relaxation and analytical ultracentrifugation analyses demonstrate that NV 3CLpro is predominantly a monomer in solution. Solution structure of NV 3CLpro shows significant structural variation in C‐terminal domain compared with crystal structures and among lower energy structure ensembles. Also, ¹⁵N spin relaxation and Carr–Purcell–Meiboom–Gill (CPMG)‐based relaxation dispersion analyses reveal the dynamic properties of residues in the C‐terminal domain over a wide range of timescales. In particular, the long loop spanning residues T123–G133 show fast motion (ps‐ns), and the residues in the bII–cII region forming the large hydrophobic pocket (S2 site) undergo conformational exchanges on slower timescales (μs–ms), suggesting their important role in substrate recognition.     

A comparison of bats and rodents as reservoirs of zoonotic viruses: are bats special?

Bats are the natural reservoirs of a number of high-impact viral zoonoses. We present a quantitative analysis to address the hypothesis that bats are unique in their propensity to host zoonotic viruses based on a comparison with rodents, another important host order. We found that bats indeed host more zoonotic viruses per species than rodents, and we identified life-history and ecological factors that promote zoonotic viral richness. More zoonotic viruses are hosted by species whose distributions overlap with a greater number of other species in the same taxonomic order (sympatry). Specifically in bats, there was evidence for increased zoonotic viral richness in species with smaller litters (one young), greater longevity and more litters per year. Furthermore, our results point to a new hypothesis to explain in part why bats host more zoonotic viruses per species: the stronger effect of sympatry in bats and more viruses shared between bat species suggests that interspecific transmission is more prevalent among bats than among rodents. Although bats host more zoonotic viruses per species, the total number of zoonotic viruses identified in bats (61) was lower than in rodents (68), a result of there being approximately twice the number of rodent species as bat species. Therefore, rodents should still be a serious concern as reservoirs of emerging viruses. These findings shed light on disease emergence and perpetuation mechanisms and may help lead to a predictive framework for identifying future emerging infectious virus reservoirs.     

Effects of Korean Red Ginseng extract on hepatic lipid accumulation in HepG2 cells

In this study, we investigated the effects of Korean red ginseng water extract (KRGE) on hepatic lipid accumulation in HepG2 cells. KRGE decreased hepatic triglyceride and cholesterol levels. Further, KRGE suppressed expression of fatty acid synthase (FAS) and 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-CoA) reductase. These results suggest that KRGE may reduce hepatic lipid accumulation by inhibition of FAS and HMG-CoA reductase expression in HepG2 cells.