Biosynthesis of Al2O3 and europium-doped Al2O3 nanoparticle using Cymbopogon citratus (lemongrass) extract and its antibacterial property

Cymbopogon citratus-mediated pure aluminium oxide (Al₂O₃) and europium (Eu)-doped Al₂O₃ with different amounts of metal ion were prepared using a green synthesis method. Synthesised nanoparticles were characterised by ultraviolet (UV)-visible spectroscopy, photoluminescence (PL), Fourier-transform infrared (FTIR) spectroscopy, X-ray diffraction (XRD) and scanning electron microscopy (SEM). Synthesis of nanoparticles is confirmed by using UV-visible spectroscopy showing maximum absorption at 411 and 345 nm for Al₂O₃ and Eu-doped Al₂O₃, respectively. The antibacterial activity of prepared nanoparticles was evaluated against Pseudomonas aeruginosa, Streptococcus aureus, Escherichia coli and Klebsiella pneumoniae using a well-diffusion technique. The effect of pure Al₂O₃ and Eu-doped nanoparticles shows excellent results against P. aeruginosa, S. aureus, E. coli and K. pneumoniae.     

A Multisite Strategy for Enhancing the Hydrogen Evolution Reaction on a Nano‐Pd Surface in Alkaline Media

The hydrogen evolution reaction (HER) on a noble metal surface in alkaline media is more sluggish than that in acidic media due to the limited proton supply. To promote the reaction, it is necessary to transform the alkaline HER mechanism via a multisite catalyst, which has additional water dissociation sites to improve the proton supply to an optimal level. Here, this study reports a top‐down strategy to create a multisite HER catalyst on a nano‐Pd surface and how to further fine‐tune the areal ratio of the water dissociation component to the noble metal surface in core/shell‐structured nanoparticles (NPs). Starting with Pd/Fe₃O₄ core/shell NPs, electrochemical cycling is used to tune the coverage of iron (oxy)hydroxide on a Pd surface. The alkaline HER activity of the core/sell Pd/FeO_x (OH)_2?2x NPs exhibits a volcano‐shaped correlation with the surface Fe species coverage. This indicates an optimum coverage level where the rates of both the water dissociation step and the hydrogen formation step are balanced to achieve the highest efficiency. This multisite strategy assigns multiple reaction steps to different catalytic sites, and should also be extendable to other core/shell NPs to optimize their HER activity in alkaline media.     

Kinetic analysis of nanoparticle‐protein interactions using a plasmon waveguide resonance

A plasmon waveguide resonance (PWR) sensor is proposed for studying the interaction between gold nanoparticles and proteins. The ability of the PWR sensor to operate in both TM and TE Polarizations, i.e. its polarization diversity, facilitates the simultaneous spectroscopy of the nanoparticles surface reactions using both polarizations. The response of each polarization to streptavidin‐biotin binding at the surface of gold nanoparticles is investigated in real time. Finally, using the principles of multimode spectroscopy, the nanoparticle's surface reactions are decoupled from the bulk solution refractive index variations.

Schematic diagram of the NP‐modified PWR sensor     

Formation of potential titanium antigens based on protein binding to titanium dioxide nanoparticles

Degradation products of titanium implants include free ions, organo-metallic complexes, and particles, ranging from nano to macro sizes. The biological effects, especially of nanoparticles, is yet unknown. The main objective of this study was to develop Ti-protein antigens in physiological solutions that can be used in testing of cellular responses. For this purpose, 0.1% TiO2 nanoparticles less than 100 nm were mixed with human serum albumin (HSA), 0.1% and 1%, in cell culture medium (DMEM, pH 7.2). The Ti concentrations in the resulting solutions were analyzed by inductively coupled plasma mass spectrometry. The stability of the nanoparticles in suspension was analyzed by UV-vis spectrophotometer and Dynamic Light Scattering. The concentration of Ti in suspension was dependent on the presence and concentration of HSA. Albumin prevented high aggregation rate of TiO2 nanoparticles in cell culture medium. It is shown that nano TiO2-protein stable aggregates can be produced under physiological conditions at high concentrations, and are candidates for use in cellular tests.     

Optical investigation of the electron transfer protein azurin-gold nanoparticle system

The hybrid system obtained by conjugating the protein azurin, which is a very stable and well-described protein showing a unique interplay among its electron transfer and optical properties, with 20-nm sized gold nanoparticles has been investigated. Binding of azurin molecules to gold nanoparticle surface results in the red shift of the nanoparticle resonance plasmon band and in the quenching of the azurin single tryptophan fluorescence signal. These findings together with the estimate of the hydrodynamic radius of the composite, obtained by means of Dynamic Light Scattering, are consistent with the formation of a monolayer of protein molecules, with preserved natural folding, on nanoparticle surface. The fluorescence quenching of azurin bound molecules is explained by an energy transfer from protein to metal surface and it is discussed in terms of the involvement of the Az electron transfer route in the interaction of the protein with the nanoparticle.     

Electrochemical nitrite biosensor based on the immobilization of hemoglobin on an electrode modified by multiwall carbon nanotubes and positively charged gold nanoparticle

The report is on an electrochemical biosensor with remarkably improved sensitivity toward nitrite. In this strategy, positively charged gold nanoparticle (PCNA) is used in combination with multiwall carbon nanotubes (MWCNT) by electrostatic adsorption for fabricating PCNA/MWCNT films. Then hemoglobin (Hb) biocatalyst will easily be attached to the surface of the combination films aforementioned. After that, the Hb/PCNA films are immobilized onto the Hb/PCNA/MWCNT films through layer-by-layer assembly technique. The (Hb/PCNA)₂/MWNT/GC electrode thus prepared exhibits enhanced electrocatalytic behavior to the reduction of nitrite at −0.10 V versus SCE in 0.05 M H₂SO₄ solution_. On condition of the low detecting potential and low pH, interference caused by direct electrochemical oxidation or oxidizable substances can be prevented. Therefore, the modified electrode shows fast response time, very high sensitivity, good selectivity and stability. The current response of the sensor increases linearly with nitrite concentration from a range of 3.6 × 10⁻⁶ to 3.0 × 10⁻³ M with a detection limit(S /N = 3) of 9.6 × 10⁻⁷ M.     

Fabrication of Biomimetic Water Strider Legs Covered with Setae

Water striders have remarkable water-repellent legs that enable them to stand effortlessly and move quickly on water.Fluidphysics indicates this feature is due to a surface-tension effect caused by the special hierarchical structure of the legs,which arecovered with a large number of inclined setae with fine nanogrooves inducing water resistance.This inspires us to fabricatespecial water-repellent structure on functional surfaces through the cooperation between the surface treatment and the surfacemicro-and nanostructures,which may bring great advantages in a wide variety of applications.In this paper we present aprocedure for fabricating biomimetic water strider legs covered with setae using Polycarbonate Track-Etched(PCTE)membranesas templates.By choosing appropriate membrane lengths,diameters,pitches and densities of the setae,the biomimeticlegs can be fabricated conveniently and at a low cost.Furthermore we investigated the relationship between stiffness of themolding materials,high aspect ratio and density,which affect the fidelity of fabrication and self adhesion,to optimize thestability of setae.The knowledge we gained from this study will offer important insights into the biomimetic design and fabricationof water strider setae.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Assessing the efficacy of vesicle fusion with planar membrane arrays using a mitochondrial porin as reporter

Reconstitution of functionally active membrane protein into artificially made lipid bilayers is a challenge that must be overcome to create a membrane-based biomimetic sensor and separation device. In this study we address the efficacy of proteoliposome fusion with planar membrane arrays. We establish a protein incorporation efficacy assay using the major non-specific porin of Fusobacterium nucleatum (FomA) as reporter. We use electrical conductance measurements and fluorescence microscopy to characterize proteoliposome fusion with an array of planar membranes. We show that protein reconstitution in biomimetic membrane arrays may be quantified using the developed FomA assay. Specifically, we show that FomA vesicles are inherently fusigenic. Optimal FomA incorporation is obtained with a proteoliposome lipid-to-protein molar ratio (LPR) = 50 more than 10⁵ FomA proteins could be incorporated in a bilayer array with a total membrane area of 2 mm² within 20 min. This novel assay for quantifying protein delivery into lipid bilayers may be a useful tool in developing biomimetic membrane applications.