Structural and functional insights into CST tethering in Tetrahymena thermophila telomerase

1. Download : Download high-res image (130KB)
2. Download : Download full-size image

     

Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Association between genetically determined telomere length and health-related outcomes: A systematic review and meta-analysis of Mendelian randomization studies

Emerging evidence has shown that leukocyte telomere length (LTL) is associated with various health-related outcomes, while the causality of these associations remains unclear. We performed a systematic review and meta-analysis of current evidence from Mendelian randomization (MR) studies on the association between LTL and health-related outcomes. We searched PubMed, Embase, and Web of Science up to April 2022 to identify eligible MR studies. We graded the evidence level of each MR association based on the results of the main analysis and four sensitive MR methods, MR-Egger, weighted median, MR-PRESSO, and multivariate MR. Meta-analyses of published MR studies were also performed. A total of 62 studies with 310 outcomes and 396 MR associations were included. Robust evidence level was observed for the association between longer LTL and increased risk of 24 neoplasms (the strongest magnitude for osteosarcoma, GBM, glioma, thyroid cancer, and non-GBM glioma), six genitourinary and digestive system outcomes of excessive or abnormal growth, hypertension, metabolic syndrome, multiple sclerosis, and clonal hematopoiesis of indeterminate potential. Robust inverse association was observed for coronary heart disease, chronic kidney disease, rheumatoid arthritis, juvenile idiopathic arthritis, idiopathic pulmonary fibrosis, and facial aging. Meta-analyses of MR studies suggested that genetically determined LTL was associated with 12 neoplasms and 9 nonneoplasm outcomes. Evidence from published MR studies supports that LTL plays a causal role in various neoplastic and nonneoplastic diseases. Further research is required to elucidate the underlying mechanisms and to bring insight into the potential prediction, prevention, and therapeutic applications of telomere length.     

Telomerase Repairs Collapsed Replication Forks at Telomeres

1. Download : Download high-res image (180KB)
2. Download : Download full-size image

     

Impact of Gln94Glu mutation on the structure and function of protection of telomere 1, a cause of cutaneous familial melanoma

Abstract

Protection of telomere 1 (POT1) is a key component of shelterin complex, essential for maintaining telomere length and its regulation. It consists of N-terminal domain (residues 1–299), which interacts with telomeric ssDNA, and the C-terminal domain (residues 320–634) that binds to the tripeptidyl-peptidase I (TPP1). A large number of naturally occurring mutations in the POT1 gene are associated with glioma, cardiac angiosarcoma and cutaneous familial melanoma (FM). In particular, Q94E mutation disrupts the interaction of POT1 with telomeric DNA which subsequently enhances telomere uncapping and elongation and promotes the development of cutaneous familial melanoma. To understand the underlying mechanism of familial melanoma developed by Q94E-mutation, we have performed extensive structure analysis of WT and mutant protein followed by molecular dynamics simulations. Q94E mutation causes a dramatic change in the structure and stability of POT1 protein. A considerable decrease in the flexibility, fluctuation and solvent accessibility of Q94E was observed in comparison to the WT, indicating overall destabilization of protein. Essential dynamics and Anisotropic Network Mode analysis have quantified a significant change in direction and magnitude of conformational motion in Q94E mutant compared to WT. A significant loss of frustration due to Q94E mutation was also observed. Our findings indicate the loss of protein stability and dynamics of POT1 protein by Q94E mutation may be associated with the familial melanoma. Abbreviations ANM anisotropic network mode

ED essential dynamics

FM familial melanoma

MD molecular dynamics

POT1 protection of telomere 1

Rg radius of gyration

RMSD root-mean-square deviation

RMSF root-mean-square fluctuations

SASA solvent accessible surface area

SIFT sorting Intolerant from Tolerant

TPP1 tripeptidyl-peptidase I

WT wild type

Communicated by Ramaswamy H. Sarma     

Initiation of telomere‐mediated chromosomal rearrangements in cancer

Telomeres are the ends of chromosomes and protect them from degradation and fusion. As such, their stability is required for normal cellular function. Telomere dysfunction is found often at the origin of cellular transformation and contributes to the onset of genomic instability, a hallmark of cancer cells. In this article, I discuss current data and concepts on telomere‐mediated chromosomal rearrangements in cancer. J. Cell. Biochem. 109: 1095–1102, 2010. © 2010 Wiley‐Liss, Inc.