Nationwide prevalence of Torque teno sus virus 1 and k2a in pig populations in Japan

Because broad genetic diversity has recently been detected in Torque teno sus viruses (TTSuV1 and TTSuVk2), the viral genome detection method needs to be improved to understand the prevalence of these viruses. Here, we established single PCR-based detection methods for the TTSuV1 and TTSuVk2a genomes with newly designed primer pairs and applied them to investigate the prevalence of TTSuV1 and TTSuVk2a in Japanese pig populations. The results revealed that 98.2% and 81.7% of the pig farms tested positive for the TTSuV1 and TTSuVk2a genomes, respectively, indicating that both TTSuV1 and TTSuVk2a are widespread in Japan.     

Genetic Engineering and Nitrogen Fixation

Molecular cloning is based on isolation of a DNA sequence of interest to obtain multiple copies of it in vitro. Application of this technique has become an increasingly important tool in clinical microbiology due to its simplicity, cost effectiveness, rapidity, and reliability. This review entails the recent advances in molecular cloning and its application in the clinical microbiology in the context of polymicrobial infections, recombinant antigens, recombinant vaccines, diagnostic probes, antimicrobial peptides, and recombinant cytokines. Culture-based methods in polymicrobial infection have many limitation, which has been overcome by cloning techniques and provide gold standard technique. Recombinant antigens produced by cloning technique are now being used for screening of HIV, HCV, HBV, CMV, Treponema pallidum, and other clinical infectious agents. Recombinant vaccines for hepatitis B, cholera, influenza A, and other diseases also use recombinant antigens which have replaced the use of live vaccines and thus reduce the risk for adverse effects. Gene probes developed by gene cloning have many applications including in early diagnosis of hereditary diseases, forensic investigations, and routine diagnosis. Industrial application of this technology produces new antibiotics in the form of antimicrobial peptides and recombinant cytokines that can be used as therapeutic agents.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Metabolic impact assessment for heterologous protein production in Streptomyces lividans based on genome-scale metabolic network modeling

The metabolic impact exerted on a microorganism due to heterologous protein production is still poorly understood in Streptomyces lividans. In this present paper, based on exometabolomic data, a proposed genome-scale metabolic network model is used to assess this metabolic impact in S. lividans. Constraint-based modeling results obtained in this work revealed that the metabolic impact due to heterologous protein production is widely distributed in the genome of S. lividans, causing both slow substrate assimilation and a shift in active pathways. Exchange fluxes that are critical for model performance have been identified for metabolites of mouse tumor necrosis factor, histidine, valine and lysine, as well as biomass. Our results unravel the interaction of heterologous protein production with intracellular metabolism of S. lividans, thus, a possible basis for further studies in relieving the metabolic burden via metabolic or bioprocess engineering.     

Soluble interleukin‐1 receptor,a potential negative regulator of orange‐spotted grouper Epinephelus coioides interleukin‐1 system

In this study, the cDNA sequence encoding interleukin‐1 (Il‐1) receptor‐like protein of orange‐spotted grouper Epinephelus coioides was obtained. The newly identified sequence was named soluble type I Il‐1 receptor (sIl‐1rI) owing to its structural composition, which had two Ig‐like domains, lack of transmembrane region and the Toll/interleukin‐1 receptor (TIR) domain, similar to the brown rat Rattus norvegicus soluble Il‐1rI. In addition, sequence comparison and phylogenetic analysis indicated that E. coioides sequence had a closer relationship with Il‐1rI than Il‐1rII. Real‐time PCR revealed that sil‐1rI mRNA expression presented a process of decrease, restoration and increase in Cryptocaryon irritans‐infected E. coioides. The negative correlation between Il‐1β and sil‐1rI mRNA in C. irritans‐infected head‐kidney implied the potential negative regulatory role of sil‐1rI in E. coioides Il‐1 system. The leucocytes incubated with lipopolysaccharide or polyriboinosinic polyribocytidylic acid exhibited different expression profiles of sil‐1rI. Recombinant Il‐1β (rIl‐1β) protein was capable of inducing sil‐1rI mRNA under the concentration of 100 ng ml^?1, suggesting that high dosage or excess Il‐1β would stimulate the expression of sil‐1rI to maintain the homoeostasis of E. coioides Il‐1 system. For the first time, the role of teleost Il‐1rI in parasite infection has been identified, and soluble Il‐1r was found in fish.     

Impact of virus preparation quality on parvovirus filter performance

Virus‐removal filtration technology is commonly used in the manufacturing process for biologics to remove potential viral contaminants. Virus‐removal filters designed for retaining parvovirus, one of the smallest mammalian viruses, are considered an industry standard as they can effectively remove broad ranges of viruses. It has long been observed that the performance of virus filters can be influenced by virus preparations used in the laboratory scale studies (PDA, 2010 ). However, it remains unclear exactly what quality attributes of virus preparations are critical or indicative of virus filter performance as measured by effectiveness of virus removal and filter capacity consistency. In an attempt to better understand the relationship between virus preparation and virus filter performance, we have systematically prepared and analyzed different grades of parvovirus with different purity levels and compared their performance profiles on Viresolve® Pro parvovirus filters using four different molecules. Virus preparations used in the studies were characterized using various methods to measure DNA and protein content as well as the hydrodynamic diameter of virus particles. Our results indicate that the performance of Viresolve® Pro filters can be significantly impacted depending on the purity of the virus preparations used in the spike and recovery studies. More importantly, we have demonstrated that the purity of virus preparations is directly correlated to the measurable biochemical and biophysical properties of the virus preparations such as DNA and protein content and monodispersal status, thus making it possible to significantly improve the consistency and predictability of the virus filter performance during process step validations. Biotechnol. Bioeng. 2013; 110: 229–239. © 2012 Wiley Periodicals, Inc.