Robust numerical solution for the two parameter solute solvent transport model

Prediction of solute and solvent transport in cells is central to developing and testing cryopreservation protocols. As we show here, however, the models used can be difficult to accurately numerically integrate in some key cases, and thus are a challenge to implement when determining the time dependent cell state during cryoprotectant equilibration and cooling. Exact solution techniques exist for overcoming this problem, but their implementation is also challenging: inversion of a nonlinear function is required that negates much of the utility of the approach. This communication describes a simple approach for more robust numerical integration that can be implemented using any numerical differential equation solver, and can facilitate arbitrarily accurate solutions to transport models without the complication of inversion formulae or complicated numerical integration schemes. Further, a simple relevant example of red blood cell equilibration with 40% glycerol is presented with comments on extending the approach to other settings.     

Fungizide: Risiken der resistenzentwicklung und suche nach neuen targets

Trotz intensiver Bemühungen im Bereich des Pflanzenschutzes sind weltweit erhebliche Verluste im Bereich pflanzlicher Erntegüter zu verzeichnen. Rund ein Drittel der Verluste werden mikrobiellen Schaderregern, also Pilzen, Bakterien und Viren, zugeschrieben. Besonders schwierig ist der Tatsache zu begegnen, dass Pilze gegenüber spezifisch wirkenden Fungiziden Insensitivitäten bzw. Resistenzen entwickeln. Aus diesem Grunde muss über geeignete Strategien beim Fungizideinsatz, beim ‘Disease management’ und bei der Suche nach neuen, hochwirksamen Fungiziden nachgedacht werden. Der Erfolg bei der Suche nach neuen Fungiziden wird stark davon abhängen, ob neue Zielmoleküle für potentielle Fungizide entdeckt werden können. Dabei können moderne molekulargenetische Techniken von großem Nutzen sein.     

Contribution of genetic and epigenetic mechanisms to Wnt pathway activity in prevalent skeletal disorders

We reported previously that the expression of Wnt-related genes is lower in osteoporotic hip fractures than in osteoarthritis. We aimed to confirm those results by analyzing β-catenin levels and explored potential genetic and epigenetic mechanisms involved.     

Explicit Solvent Molecular Dynamics Simulation of Duplex Formed by the Modified Oligonucleotide with Alternating Phosphate/Phosphonate Internucleoside Linkages and its Natural Counterpart

Abstract

Impact of the internucleoside linkage modification by inserting a methylene group on the ability of the modified oligonucleotide to hybridize with a natural DNA strand was studied by fully solvated molecular dynamics (MD) simulations. Three undecamer complexes were analyzed: natural dT₁₁.dA₁₁ duplex as a reference and two its analogs with alternating modified and natural linkages in the deoxyadenosine chain. The isopolar, non-isosteric modified linkages were of 5′-O-PO₂-CH₂-O-3′ (5′PC3′) or 5′-O-CH₂-PO₂-O-3′ (5′CP3′) type. Simulations were performed by using the AMBER 5.0 software package with the force field completed by a set of parameters needed to model the modified segments. Both modifications were found to lead to double helical complexes, in which the thymidine strand as well as deoxyriboses and unmodified linkages in the adenosine strand adopted conformations typical for the B-type structure. For each of the two conformational richer modified linkages two stable conformations were found at 300 K: the -ggt and ggt for the 5′PC3′ and ggg, tgg for the 5′CP3′, respectively. Both modified chains adopted helical conformations with heightened values of the inclination parameter but without affecting the Watson-Crick hydrogen bonds.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Indinavir and nelfinavir inhibit proximal insulin receptor signaling and salicylate abrogates inhibition: Potential role of the NFkappa B pathway

The molecular basis of insulin resistance induced by HIV protease inhibitors (HPIs) remains unclear. In this study, Chinese hamster ovary cells transfected with high levels of human insulin receptor (CHO‐IR) and 3T3‐L1 adipocytes were used to elucidate the mechanism of this side effect. Indinavir and nelfinavir induced a significant decrease in tyrosine phosphorylation of the insulin receptor β‐subunit. Indinavir caused a significant increase in the phosphorylation of insulin receptor substrate‐1 (IRS‐1) on serine 307 (S307) in both CHO‐IR cells and 3T3‐L1 adipocytes. Nelfinavir also inhibited phosphorylation of Map/ERK kinase without affecting insulin‐stimulated Akt phosphorylation. Concomitantly, levels of protein tyrosine phosphatase 1B (PTP1B), suppressor of cytokines signaling‐1 and ‐3 (SOCS‐1 and ‐3), Src homology 2B (SH2B) and adapter protein with a pleckstrin homology domain and an SH2 domain (APS) were not altered significantly. When CHO‐IR cells were pre‐treated with sodium salicylate (NaSal), the effects of indinavir on tyrosine phosphorylation of the IR β‐subunit and phosphorylation of IRS‐1 at S307 were abrogated. These data suggest a potential role for the NFκB pathway in insulin resistance induced by HPIs. J. Cell. Biochem. 114: 1729–1737, 2013. © 2013 Wiley Periodicals, Inc.     

Population-response model for vibrotactile spatial summation

A computational model based on previous physiological and psychophysical data is presented for the human Pacinian (P) psychophysical channel. The model can predict the probability of detection in simple psychophysical tasks, and hence psychometric functions and thresholds. The model simulates stimulating variable and fixed glabrous skin sites with different-sized contactors and includes spatial variation of monkey P-fiber sensitivities. Therefore, it is especially suitable for studying spatial summation, i.e. the improvement of threshold with increasing contactor area. Selective contributions of neural integration (n.i.) and probability summation (p.s.) are also incorporated into the model. Model predictions are compared to psychophysical results of Gescheider et al. (). The performance of the model regarding the effects of contactor size is very good. In addition to predicting approximately 3?dB improvement of thresholds when the contactor area is doubled, the model also reveals nonlinear contributions of p.s. and n.i. Furthermore, the model asserts that thresholds are largely governed by neural integration when small contactors are used. These and other findings discussed in the article show that the presented model is a helpful tool for formulating testable hypotheses. Although the model can also simulate some temporal summation effects, simulation results do not conform well to previous data on temporal response properties. Thus, the model needs to be refined in that respect.     

Modeling the synergy between HSV-2 and HIV and potential impact of HSV-2 therapy

Mounting evidence indicates that genital HSV-2 infection may increase susceptibility to HIV infection and that co-infection may increase infectiousness. Accordingly, antiviral treatment of people with HSV-2 may mitigate the incidence of HIV in populations where both pathogens occur. To better understand the epidemiological synergy between HIV and HSV-2, we formulate a deterministic compartmental model that describes the transmission dynamics of these pathogens. Unlike earlier models, ours incorporates gender and heterogeneous mixing between activity groups. We derive explicit expressions for the reproduction numbers of HSV-2 and HIV, as well as the invasion reproduction numbers via next generation matrices. A qualitative analysis of the system includes the local and global behavior of the model. Simulations reinforce these analytical results and demonstrate epidemiological synergy between HSV-2 and HIV. In particular, numerical results show that HSV-2 favors the invasion of HIV, may dramatically increase the peak as well as reducing the time-to-peak of HIV prevalence, and almost certainly has exacerbated HIV epidemics. The potential population-level impact of HSV-2 on HIV is demonstrated by calculating the fraction of HIV infections attributable to HSV-2 and the difference between HIV prevalence in the presence and absence of HSV-2. The potential impact of treating people with HSV-2 on HIV control is demonstrated by comparing HIV prevalence with and without HSV-2 therapy. Most importantly, we illustrate that the aforementioned aspects of the population dynamics can be significantly influenced by the sexual structure of the population.