Contribution of genetic and epigenetic mechanisms to Wnt pathway activity in prevalent skeletal disorders

We reported previously that the expression of Wnt-related genes is lower in osteoporotic hip fractures than in osteoarthritis. We aimed to confirm those results by analyzing β-catenin levels and explored potential genetic and epigenetic mechanisms involved.     

Explicit Solvent Molecular Dynamics Simulation of Duplex Formed by the Modified Oligonucleotide with Alternating Phosphate/Phosphonate Internucleoside Linkages and its Natural Counterpart

Abstract

Impact of the internucleoside linkage modification by inserting a methylene group on the ability of the modified oligonucleotide to hybridize with a natural DNA strand was studied by fully solvated molecular dynamics (MD) simulations. Three undecamer complexes were analyzed: natural dT₁₁.dA₁₁ duplex as a reference and two its analogs with alternating modified and natural linkages in the deoxyadenosine chain. The isopolar, non-isosteric modified linkages were of 5′-O-PO₂-CH₂-O-3′ (5′PC3′) or 5′-O-CH₂-PO₂-O-3′ (5′CP3′) type. Simulations were performed by using the AMBER 5.0 software package with the force field completed by a set of parameters needed to model the modified segments. Both modifications were found to lead to double helical complexes, in which the thymidine strand as well as deoxyriboses and unmodified linkages in the adenosine strand adopted conformations typical for the B-type structure. For each of the two conformational richer modified linkages two stable conformations were found at 300 K: the -ggt and ggt for the 5′PC3′ and ggg, tgg for the 5′CP3′, respectively. Both modified chains adopted helical conformations with heightened values of the inclination parameter but without affecting the Watson-Crick hydrogen bonds.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Indinavir and nelfinavir inhibit proximal insulin receptor signaling and salicylate abrogates inhibition: Potential role of the NFkappa B pathway

The molecular basis of insulin resistance induced by HIV protease inhibitors (HPIs) remains unclear. In this study, Chinese hamster ovary cells transfected with high levels of human insulin receptor (CHO‐IR) and 3T3‐L1 adipocytes were used to elucidate the mechanism of this side effect. Indinavir and nelfinavir induced a significant decrease in tyrosine phosphorylation of the insulin receptor β‐subunit. Indinavir caused a significant increase in the phosphorylation of insulin receptor substrate‐1 (IRS‐1) on serine 307 (S307) in both CHO‐IR cells and 3T3‐L1 adipocytes. Nelfinavir also inhibited phosphorylation of Map/ERK kinase without affecting insulin‐stimulated Akt phosphorylation. Concomitantly, levels of protein tyrosine phosphatase 1B (PTP1B), suppressor of cytokines signaling‐1 and ‐3 (SOCS‐1 and ‐3), Src homology 2B (SH2B) and adapter protein with a pleckstrin homology domain and an SH2 domain (APS) were not altered significantly. When CHO‐IR cells were pre‐treated with sodium salicylate (NaSal), the effects of indinavir on tyrosine phosphorylation of the IR β‐subunit and phosphorylation of IRS‐1 at S307 were abrogated. These data suggest a potential role for the NFκB pathway in insulin resistance induced by HPIs. J. Cell. Biochem. 114: 1729–1737, 2013. © 2013 Wiley Periodicals, Inc.     

Population-response model for vibrotactile spatial summation

A computational model based on previous physiological and psychophysical data is presented for the human Pacinian (P) psychophysical channel. The model can predict the probability of detection in simple psychophysical tasks, and hence psychometric functions and thresholds. The model simulates stimulating variable and fixed glabrous skin sites with different-sized contactors and includes spatial variation of monkey P-fiber sensitivities. Therefore, it is especially suitable for studying spatial summation, i.e. the improvement of threshold with increasing contactor area. Selective contributions of neural integration (n.i.) and probability summation (p.s.) are also incorporated into the model. Model predictions are compared to psychophysical results of Gescheider et al. (). The performance of the model regarding the effects of contactor size is very good. In addition to predicting approximately 3?dB improvement of thresholds when the contactor area is doubled, the model also reveals nonlinear contributions of p.s. and n.i. Furthermore, the model asserts that thresholds are largely governed by neural integration when small contactors are used. These and other findings discussed in the article show that the presented model is a helpful tool for formulating testable hypotheses. Although the model can also simulate some temporal summation effects, simulation results do not conform well to previous data on temporal response properties. Thus, the model needs to be refined in that respect.     

Modeling the synergy between HSV-2 and HIV and potential impact of HSV-2 therapy

Mounting evidence indicates that genital HSV-2 infection may increase susceptibility to HIV infection and that co-infection may increase infectiousness. Accordingly, antiviral treatment of people with HSV-2 may mitigate the incidence of HIV in populations where both pathogens occur. To better understand the epidemiological synergy between HIV and HSV-2, we formulate a deterministic compartmental model that describes the transmission dynamics of these pathogens. Unlike earlier models, ours incorporates gender and heterogeneous mixing between activity groups. We derive explicit expressions for the reproduction numbers of HSV-2 and HIV, as well as the invasion reproduction numbers via next generation matrices. A qualitative analysis of the system includes the local and global behavior of the model. Simulations reinforce these analytical results and demonstrate epidemiological synergy between HSV-2 and HIV. In particular, numerical results show that HSV-2 favors the invasion of HIV, may dramatically increase the peak as well as reducing the time-to-peak of HIV prevalence, and almost certainly has exacerbated HIV epidemics. The potential population-level impact of HSV-2 on HIV is demonstrated by calculating the fraction of HIV infections attributable to HSV-2 and the difference between HIV prevalence in the presence and absence of HSV-2. The potential impact of treating people with HSV-2 on HIV control is demonstrated by comparing HIV prevalence with and without HSV-2 therapy. Most importantly, we illustrate that the aforementioned aspects of the population dynamics can be significantly influenced by the sexual structure of the population.     

Gender identity and integration: second-generation Somali immigrants navigating gender in Canada

Many right-leaning politicians claim that normative Islamic perspectives on gender are at odds with the Western values and act as barriers to immigrant integration. Our interviews with 256 second-generation Somali-Canadians, however, suggest that gender-egalitarian identities are achieved – they are constructed and deployed by our participants to practice integration and express belonging in Canada. In this study, we move beyond analysis of attaining gender-egalitarian roles as a result of immigration and propose an understanding of gender as a form of Bourdieusian cultural capital that, depending on social values, functions as symbolic capital rendering individuals and groups as advantaged or disadvantaged. We, therefore, analyse modalities of “doing” gender as potential strategies of accumulating capital in furthering successful integration. Our study contributes to the emergent literature in migration studies that examines gender in relation to ethnic and national identities, and the extent to which it may impact integration experiences of second-generation Muslim immigrants.     

‘Have you got the Britísh?’: narratives of migration and settlement among Albanian-origin immigrants in London

Studies on migration and integration in Britain have noted the paucity of research on ‘new’ migrants, especially ‘illegal’ migrants and asylum seekers. This paper focuses on one understudied group – Albanian immigrants and their children – and looks at their migration and settlement, based on sixty interviews conducted in two phases either side of a 2003 mini-amnesty that gave many indefinite leave to remain. This regularization is the fulcrum around which our analytical narrative is built. Focusing on the interaction of migrants' agency with host-country structure, the paper shows that an unsettled asylum policy and delays in implementation have had deleterious effects on migrants' integration and sense of belonging, even after citizenship acquisition. As they search for a social and ethnic positioning within a multi-ethnic host society, the eventual realization of Albanians' migration project is accompanied by culture shock, intergenerational difference and ambivalence towards integration.     

Challenging the racialization of child sexual exploitation: Muslim men,racism and belonging in Rotherham

This paper presents findings from original research exploring the impact on Muslim men of a child sexual exploitation scandal that attracted significant attention to the northern English town where they live and contributed to a sustained detrimental effect on local community relations. It foregrounds men’s accounts to reveal their agency and resilience in responding to racism that they identified as resulting from the scandal. It reveals how their accounts disrupt dominant discourses foregrounding Muslim self-segregation and lack of integration, demonstrating positive attachments and claims to localized space, and commitment to belonging. In doing so, it shows how men’s responses to racism challenge racialized forms of knowledge about Muslims. The paper draws attention to the significance of localized forms of belonging in facilitating the inclusion of Muslim minorities. It also highlights the importance of centring Muslim men as historically speaking subjects in accounts of issues involving them.