Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Adjusting for regression effect in uncontrolled studies

When clinical studies require enrolled patients to have abnormal assays, the natural tendency of repeat measurements to regress toward the mean can lead to a false assessment of effectiveness of therapy. We propose a method to more accurately estimate the true effect of therapy by adjusting for a component of improvement that can be attributed to regression effect. The model we use allows for a combination of additive and/or multiplicative effects of the therapy.     

Synthesis and BZR affinity of pyrazolo[1,5-a]pyrimidine derivatives. Part 1: study of the structural features for BZR recognition

Examination of the pharmacophoric points of the pyrazolo[1,5-a]pyrimidine derivatives, ligands for BZR, previously published led us to the design of a novel class of 3,6-diaryl-4,7-dihydro-pyrazolo[1,5-a]pyrimidin-7-ones and to determine the groups involved in the BZR recognition.     

Power and sample size for testing homogeneity of relative risks in prospective studies

Power and sample-size formulas for testing the homogeneity of relative risks using the score method are presented. The homogeneity score test (Gart, 1985, Biometrika 72, 673-677) is formally equivalent to the Pearson chi-square test, although they look different. Results of this paper may be useful in assessing the validity of the model of a common relative risk before combining several 2 x 2 tables or in designing a prospective study for detecting heterogeneity of relative risks.     

The value of biodiversity experiments

Recent biodiversity experiments have investigated the relationship between diversity and ecosystem functioning by synthesizing plant communities from pools of species that have been experimentally manipulated to vary numbers and types of species present while holding abiotic factors constant. Biodiversity experiments therefore focus on a previously under-explored aspect of global change: the feedback from diversity to environment. Consequences of random manipulation of species communities may not correspond well to those of specific extinction sequences observed in the past in response to extinction drivers that cause highly non-random loss. However, random manipulation provides a good starting point given that existing communities could undergo many alternative orders of species loss in the future in response to a variety of different potential extinction drivers. Further, the effects of some extinction drivers are currently poorly understood and therefore difficult to predict (e.g. climate change) and it may be premature to dismiss the predictions of random scenarios as irrelevant to all real examples of species loss. The first generations of biodiversity experiments have provided valuable, and sometimes unexpected, discoveries about the general nature of the relationship between diversity and ecosystem functioning. These discoveries could not have been made using observational studies. We propose that different examples of extinction loss in the real or a potential future world form a continuum from situations where the results of the first-generation biodiversity experiments will be highly relevant to less relevant. At the one extreme are examples where the effects of biodiversity on ecosystem functioning will be overwhelmed by direct effects of the extinction driver on processes (e.g. chronic eutrophication). At the other extreme are situations where ecosystem processes are not strongly affected by direct effects of the extinction driver and where the effects of species loss on functioning may be more important (e.g. habitat fragmentation). Given the unprecedented uncertainty about the future of biodiversity and the functioning of ecosystems, a general approach with randomly varying species pools was the right place to start in order to provide a general foundation. The new challenge is to test for effects of biodiversity on functioning in real-world examples of species loss.

Zusammenfassung

Biodiversitätsversuche zeichnen sich dadurch aus, dass natürliche Artenpools experimentell reduziert werden und anschließend der Zusammenhang zwischen der Artenzahl und Ökosystemfunktionen unter konstanten abiotischen Umweltbedingungen untersucht wird. Dadurch unterscheiden sich Biodiversitätsexperimente grundsätzlich von anderen Versuchen, die die Biodiversität als Zielvariable behandeln und stattdessen die abiotische Umwelt manipulieren. Die Auswahl der Arten für die reduzierten Artenpools in Biodiversitätsexperimenten erfolgte bisher meist zufällig, während natürliche Aussterbefaktoren wie Eutrophierung nicht alle Arten gleichermassen gefährden. Für verschiedene Aussterbefaktoren ist aber so wenig bekannt, dass ein zufälliges Aussterbeszenario die beste gegenwärtig verfügbare Option ist. Dies trifft insbesondere für mögliche zukünftige Aussterbeprozesse zu, die durch globale Umweltveränderungen (Klima, biologische Invasionen) oder Habitatsfragmentierung ausgelöst werden könnten. Die erste Generation von Biodiversitätsexperimenten mit zufälligen Aussterbeszenarien hat wertvolle, teilweise unerwartete, generelle Zusammenhänge zwischen Artenzahl und Ökosystemfunktionen aufgedeckt. Diese Zusammenhänge ließen sich durch vergleichende Studien nicht erkennen. In Zukunft sollten Biodiversitätsexperimente dennoch vermehrt Aussterbeszenarien simulieren, die in der realen Umwelt mit größter Wahrscheinlichkeit auftreten.     

Crystallization and preliminary X-ray structural studies of hemoglobin A2 and hemoglobin E,isolated from the blood samples of beta-thalassemic patients

Hemoglobin A(2) (alpha(2)delta(2)), a minor (2-3%) component of circulating red blood cells, acts as an anti-sickling agent and its elevated concentration in beta-thalassemia is a useful clinical diagnostic. In beta-thalassemia major, where there is a failure of beta-chain production, HbA(2) acts as the predominant oxygen delivery mechanism. Hemoglobin E, is another common abnormal hemoglobin, caused by splice site mutation in exon 1 of beta globin gene, when combines with beta-thalassemia, causes severe microcytic anemia. The purification, crystallization, and preliminary structural studies of HbA(2) and HbE are reported here. HbA(2) and HbE are purified by cation exchange column chromatography in presence of KCN from the blood samples of individuals suffering from beta-thalassemia minor and E beta-thalassemia. X-ray diffraction data of HbA(2) and HbE were collected upto 2.1 and 1.73 A, respectively. HbA(2) crystallized in space group P2(1) with unit cell parameters a=54.33 A, b=83.73 A, c=62.87 A, and beta=99.80 degrees whereas HbE crystallized in space group P2(1)2(1)2(1) with unit cell parameters a=60.89 A, b=95.81 A, and c=99.08 A. Asymmetric unit in each case contains one Hb tetramer in R(2) state.     

A new dose-finding design for bivariate outcomes

For some drugs, toxicity events lead to early termination of treatment before a therapeutic response is observed. That is, there are three possible outcomes: toxicity (therapeutic response unknown), therapeutic response without toxicity, and no response with no toxicity. The optimal dose is the dose that maximizes the probability of the joint event, response, and no toxicity. The optimal safe dose is the dose, from among the doses with toxicity rate less than the maximum tolerable level, that maximizes the probability of response and no toxicity. We present a new sequential design to maximize the number of subjects assigned in the neighborhood of the optimal safe dose in a dose-finding trial with two outcomes.     

Penalized estimating equations

Penalty models--such as the ridge estimator, the Stein estimator, the bridge estimator, and the Lasso-have been proposed to deal with collinearity in regressions. The Lasso, for instance, has been applied to linear models, logistic regressions, Cox proportional hazard models, and neural networks. This article considers the bridge penalty model with penalty sigma(j)/beta(j)/gamma for estimating equations in general and applies this penalty model to the generalized estimating equations (GEE) in longitudinal studies. The lack of joint likelihood in the GEE is overcome by the penalized estimating equations, in which no joint likelihood is required. The asymptotic results for the penalty estimator are provided. It is demonstrated, with a simulation and an application, that the penalized GEE potentially improves the performance of the GEE estimator, and enjoys the same properties as linear penalty models.     

Conditional logistic analysis of case-control studies with complex sampling

Methods for the analysis of unmatched case-control data based on a finite population sampling model are developed. Under this model, and the prospective logistic model for disease probabilities, a likelihood for case-control data that accommodates very general sampling of controls is derived. This likelihood has the form of a weighted conditional logistic likelihood. The flexibility of the methods is illustrated by providing a number of control sampling designs and a general scheme for their analyses. These include frequency matching, counter-matching, case-base, randomized recruitment, and quota sampling. A study of risk factors for childhood asthma illustrates an application of the counter-matching design. Some asymptotic efficiency results are presented and computational methods discussed. Further, it is shown that a 'marginal' likelihood provides a link to unconditional logistic methods. The methods are examined in a simulation study that compares frequency and counter-matching using conditional and unconditional logistic analyses and indicate that the conditional logistic likelihood has superior efficiency. Extensions that accommodate sampling of cases and multistage designs are presented. Finally, we compare the analysis methods presented here to other approaches, compare counter-matching and two-stage designs, and suggest areas for further research.To whom correspondence should be addressed.     

Acid-catalyzed isomerization of methyl 2-deoxy-D-arabino-hexosides: equilibria, kinetics and mechanism

Four isomers of methyl 2-deoxy-D-arabino-hexosides were isolated by HPLC as chromatographically homogeneous compounds. The rates of pyranoside isomerization (alpha(p) and beta(p)) at 40 degrees C and of furanoside isomerization (alpha(f) and beta(f)) at 26 degrees C were determined. A mechanism has been suggested for transformations taking place during isomerization of methyl 2-deoxy-D-arabino-hexosides in methanolic solution catalyzed with hydrogen chloride.