The association of oxidative stress with arterial compliance and vascular resistance in a bi-ethnic population: the SABPA study

A loss of arterial elasticity increases the risk for cardiovascular events. Oxidative injury to the vessel wall may be one of the underlying mechanisms influencing arterial elasticity. We compared markers of oxidative stress, antioxidant capacity, inflammation, windkessel compliance (Cwk), and total peripheral resistance (TPR) in black and white South Africans. Associations of arterial compliance and vascular resistance (as indicated by TPR) with oxidative stress, antioxidant capacity and inflammatory markers were also investigated. We included 146 black and 181 white men and women. Measurements from the Finometer device were used to calculate Cwk and TPR while thiobarbituric acids reactive substances (TBARS), glutathione peroxidase (GPx), C-reactive protein (CRP), and interleukin-6 (IL-6) were analyzed in serum or urine samples. Black participants had higher TPR, TBARS, GPx, CRP, and IL-6 levels (all p?≤?0.018) and lower Cwk (both p?≤?0.013) compared to white participants. Multiple regression analyses revealed independent associations of Cwk (β?=??0.27, p?=?0.015) and TPR (β?=?0.18, p?=?0.018) with TBARS in black participants, while Cwk (β?=??0.10; p?=?0.019) and TPR (β?=?0.13, p?=?0.047) were independently associated with GPx in white participants. Decreased arterial compliance and increased vascular resistance associated with increased oxidative damage independent of hypertensive status in black participants. These results suggest that oxidative stress plays a role in early vascular changes in a black population prone to the development of cardiovascular disease.     

In-situ characterization of the uncrimping process of arterial collagen fibers using two-photon confocal microscopy and digital image correlation

Uncrimping of collagen fibers in the arterial wall is an integral process in regulating the macro-level mechanical response of arteries. Uncrimping of collagen fibers leads to a gradual, but significant strain-stiffening response of the artery at physiological pressures and prevents overdistention at elevated pressures. In this study, we imaged adventitial collagen fibers from fresh primate arteries using two-photon excitation microscopy while subjecting the arteries to physiological inflation pressures and axial stretches. The imaging focal plane was fixed at a constant radial location in the adventitial wall by adjusting the focal distance as the arteries inflated, allowing for the continuously monitoring of the uncrimping process of a single region of collagen fibers. Digital image correlation was then applied to the sequential images to assess and correlate the local displacements to manual traces of selected reference fibers and their engagements. We found that the collagen fibers of interest became fully engaged at a luminal pressure of 20 mmHg, this was then followed by rotation of these fibers as the bulk artery continued to dilate. This technique helps to further the understanding of the uncrimping process of collagen fibers under physiological loads, which can aid in the development of more accurate microstructural constitutive models.     

Specific and Nonspecific Visual Influences on the Stability of the Vertical Posture in Humans

We studied physiological mechanisms of vision-related stabilization of the vertical posture in humans using a stabilographic technique; spontaneous deviations of the projection of the center of gravity during quiet stance and magnitudes of the postural response to vibratory stimulation of proprioceptors of the lower leg muscles under varied conditions of visual control were measured. The stability of quiet stance, as estimated according to the root mean square value of the sagittal component of the stabilogram, was the best with eyes open. Vibration-induced postural responses were the smallest also under these conditions. Spontaneous postural sway and the amplitude of response to vibratory stimulation increased when only a central sector of visual field (20 ang. deg) was preserved and, especially, under conditions of closed eyes and horizontal inversion of visual perception using prismatic spectacles. Parallel changes in the quantitative stabilographic indices and amplitude of vibration-induced postural responses show that the intensity of the latter is probably determined by the background stiffness of the musculoskeletal system. We tried to estimate separately the contributions of the stiffness factor, on the one hand, and specific visual influences, on the other hand, by testing the parameters of quiet stance and postural responses under conditions of standing while lightly touching a support with the index finger. We found that the influence of the conditions of visual control on the stability of quiet stance while touching the support was eliminated. At the same time, the magnitude of postural responses to vibratory stimulation decreased but, nonetheless, changed with visual conditions in the same manner as when standing without additional support. We conclude that vision performs a dual function in the control of the vertical posture; it forms the basis for the spatial reference system and serves the source of information on the movements of one's body.     

Chemokine CC-motif ligand 2 participates in platelet function and arterial thrombosis by regulating PKCα-P38MAPK-HSP27 pathway

Background

Studies indicate that chemokine CC-motif ligand 2 (CCL2) is involved in inflammation and atherosclerosis. However, the roles and mechanisms of CCL2 on platelet function and arterial thrombosis are unknown.

Changes in nano‐mechanical properties of human epidermal cornified cells depending on their proximity to the skin surface

During formation of the stratum corneum (SC) barrier, terminally differentiated keratinocytes continue their maturation process within the dead superficial epidermal layer. Morphological studies of isolated human corneocytes have revealed differences between cornified envelopes purified from the deep and superficial SC. We used atomic force microscopy to measure the mechanical properties of native human corneocytes harvested by tape‐stripping from different SC depths. Various conditions of data acquisition have been tested and optimized, in order to obtain exploitable and reproducible results. Probing at 200 nN allowed us to investigate the total stiffness of the cells (at 50 nm indentation) and that of the cornified envelopes (at 10 to15 nm), and lipid envelopes (at 5 to 10 nm). The obtained data indicated statistically significant differences between the superficial (more rigid) and deep (softer) corneocytes, thus confirming the existence of depth and maturation‐related morphological changes within the SC. The proposed approach can be potentially used for minimally invasive evaluation of various skin conditions such as aging, skin hydration, and pathologies linked to SC.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

Light-Dark Difference in Arterial Pressure Variability During REM Sleep in the Rat

We have observed mean arterial pressure (MAP) variability during rapid eye movement (REM) sleep and brain temperature (Tb) in the rat during both light and dark periods over 24 h. MAP was measured using a telemetric device with a computer data capture and analysis system. As markers of MAP variability, the maximum and coefficient of variation (CV%) of MAP during REM sleep were determined. The following results were obtained: (a) there was a light-dark difference in MAP during non-REM (NREM) sleep and Tb during both NREM and REM sleep; (b) the increase of MAP in going from NREM to REM sleep in the light period was greater than that in the dark period, whereas the increase of Tb in the light period was not different from that in the dark period; (c) the maximum and CV% for MAP during REM sleep in the light period were greater than those in the dark period; (d) there was a negative correlation between the average Tb and MAP CV% during REM sleep. We suggest that phasic fluctuation of MAP during REM sleep may be influenced, in part, by a factor independent of sleep mechanisms.     

Expression of titin isoforms in red and white muscle fibres of carp (Cyprinus carpio L.) exposed to different sarcomere strains during swimming

Titin (also known as connectin) is a striated-muscle-specific protein that spans the distance between the Z- and M-lines of the sarcomere. The elastic segment of the titin molecule in the I-band is thought to be responsible for developing passive tension and for maintaining the central position of thick filaments in contracting sarcomeres. Different muscle types express isoforms of titin that differ in their molecular mass. To help to elucidate the relation between the occurrence of titin isoforms and the functional properties of different fibre types, we investigated the presence of different titin isoforms in red and white fibres of the axial muscles of carp. Gel electrophoresis of single fibres revealed that the molecular mass of titin was larger in red than in white fibres. Fibres from anterior and posterior axial muscles were also compared. For both white and red fibres the molecular mass of titin in posterior muscle fibres was larger than in anterior muscle fibres. Thus, the same fibre type can express different titin isoforms depending on its location along the body axis. The contribution of titin to passive tension and stiffness of red anterior and posterior fibres was also determined. Single fibres were skinned and the sarcomere length dependencies of passive tension and passive stiffness were determined. Measurements were made before and after extracting thin and thick filaments using relaxing solutions with 0.6 mol · l⁻¹ KCl and 1 mol · l⁻¹ KI. Tension and stiffness measured before extraction were assumed to result from both titin and intermediate filaments, and tension after extraction from only intermediate filaments. Compared to mammalian skeletal muscle, intermediate filaments developed high levels of tension and stiffness in both posterior and anterior fibres. The passive tension-sarcomere length curve of titin increased more steeply in red anterior fibres than in red posterior fibres and the curve reached a plateau at a shorter sarcomere length. Thus, the smaller titin isoform of anterior fibres results in more passive tension and stiffness for a given sarcomere strain. During continuous swimming, red fibres are exposed to larger changes in sarcomere strain than white fibres, and posterior fibres to larger changes in strain than anterior fibres. We propose that sarcomere strain is one of the functional parameters that modulates the expression of different titin isoforms in axial muscle fibres of carp. Accepted: 7 May 1997