Site-specific integration of genes into hot spots for recombination flanking aadA in Tn21 transposons.

Summary Tn21-related transposons are widespread among bacteria and carry various resistance determinants at preferential sites, hs1 and hs2. In an in vivo integrative recombination assay it was demonstrated that these hot spots direct the integration of aminoglycoside resistance genes like aadB from Klebsiella pneumoniae and aacAI from Serratia marcescens, in a recA ^– background. The maximum required recognition sequence which must be present in both the donor and recipient plasmids is 5 CTAAAACAAAGTTA 3 (hs2). The double-site-specific recombination occurred with a frequency of 10^–5–10^–6. The resulting structures include not only replicon fusion products but also more complex structures carrying two copies of the donor plasmid or simply the donor gene flanked by hs elements. hs1 and hs2 are thought to act as recognition sites for a trans-acting site-specific recombinase. By the use of Tn21 deletion derivatives, it has been shown that the recombinase is not encoded by Tn21. This new integrative recombination system is involved in the acquisition of new genes by Tn21-related transposons and their spread among bacterial populations.     

Clonal integration and effects of simulated herbivory in old-field perennials

Summary We compared the growth, phenology and leaf demography of partly defoliated, connected shoots with that of partly defoliated, severed shoots in four old-field perennials (Solidago canadensis, S. altissima, S. gigantea, Aster lanceolatus) with differing genet architectures (rhizome systems), in a common garden and in the field. Our main hypothesis was that defoliation would have fewer negative effects on shoot performance if shoots were connected than if their rhizomes were severed. Since degree of clonal integration is related to differences in genet architecture, our second hypothesis was that the effects of defoliation would be less pronounced in more integrated than in less integrated clones. Removing about 50% of the total leaf area from shoots had different effects depending on plant species, shoot density, and in particular whether rhizome connections between shoots were left intact or severed. In agreement with our prediction, experimentally isolated shoots in the field or in high density clumps in the garden suffered the most from defoliation, while shoots with intact connections or in low density clumps suffered the least. Our second prediction was neither confirmed nor falsified in the present study. Solidago altissima showed overcompensation in response to simulated herbivory in the common garden, i.e. defoliated shoots grew faster and were larger at harvest than their non-defoliated neighbours.     

The Role of Voluntary Industry Standards in Environmental Supply-Chain Management

Our article uses a new institutional economics (NIE) framework to explore the role of voluntary industry standards in the development and implementation of environmental supplier-management programs in the computer industry. We examine two different voluntary standards, one for the management of design for environment (DfE) in the semiconductor fabrication equipment sector and the other for assessing the implementation and use of environmental management systems throughout the computer industry supply chain. We compare and contrast the two standards to explain why the former was widely adopted and has helped integrate DfE into buyer-supplier relations among adopters, whereas the latter failed to gain acceptance. In line with NIE logic, both standards aimed to lower transaction and customization costs by setting "rules of the game" for interfirm transactions that would help simplify and routinize novel environmental supply-chain programs and activities. Their differential success can be elucidated in terms of how well each met the NIE criteria for remediableness and legitimacy. We conclude that voluntary standards have the potential to play an important role in promoting DfE in industrial supply chains. We further conclude that NIE provides a conceptual framework of great value to industrial ecologists who analyze how industry standards and other institutions help firms move toward more sustainable supply-chain management practices.     

A model for the mechanism of precise integration of a microinjected transgene

A unique transgenic mouse line has undergone transgene integration in a very precise fashion. The phenotype displayed by mice of the line followed the predicted inheritance patterns for X-linked transgene insertion which has been confirmed. In order to investigate the mechanism of integration the DNA sequence of the transgene and cellular junctions have been determined. A comparison between wild type and transgenic mutant sequences at the site of insertion revealed that there was no loss or rearrangement of cellular DNA upon integration of the transgene. The cellular sequences at the transgene 5 and 3 joins are contiguous in the wild type. The integrant exists as a head to tail tandem dimer with minimal loss of sequence compared with the injected monomer. Analysis of the site of insertion has revealed a 5 bp homology between the 5 end of the transgene and the cellular sequences. In addition, adjacent to the site of insertion within the cellular sequences, there are several sequence motifs implicated in recombination events including a clustering of strong consensus sites for DNA topoisomerase type I and a region of homology to the human minisatellite consensus core sequence, theEscherichia coli Chi site and the meiotic recombination hotspot within the E gene of the murine major histocompatibility complex. This clustering of features is likely to have been factorial in the integrity of the insertion event. A model depicting the mechanism of this precise integration is proposed.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.