Specific inhibition of human granulocyte elastase with peptide aldehydes

The kinetic features of human granulocyte elastase, chymotrypsin, porcine pancreatic elastase and elastomucoproteinase were compared. Amino acyl ester substrates were assayed and Km and kcat values were defined. Aldehyde analogues of the p-nitroanilide substrates designed for granulocyte elastase as optimal for Km appeared to be potent inhibitors. Suc-D-Phe-Pro-valinal (Ki = 40 microM) was found to inhibit granulocyte elastase competitively and specifically when measured with synthetic substrates, and the Ki was 3 microM with the natural protein substrate, elastin.     

Polymorphic tandem repeat region in interleukin-1α intron 6

Analysis of polymerase chain reaction amplified products from the sixth intron of the human interleukin-1 gene reveals a high polymorphism (polymorphism information content = 0.51) in a Caucasian population. Altogether, seven alleles have been defined ranging from 620 to 1220bp. This polymorphism is probably attributable to a variable number of 46-bp tandem repeats, each containing potential regulatory sequences.     

Vagal nerve and the gastric mucosal defense

An essential role for an intact vagal nerve has been proven in the development of gastric mucosal cyto- and general protection. On the other hand, chemically-induced (ethanol, HCl, indomethacin) gastric mucosal damage is enhanced after acute surgical vagotomy. The aims of this paper were to study the possible mechanisms of the vagal nerve in the development of gastric mucosal defense. The following questions were addressed: 1) effect of surgical vagotomy on the development of ethanol- (ETOH), HCl-, and indomethacin (IND)-induced gastric mucosal damage; 2) changes in the gastric mucosal defense by scavengers, prostacyclin and other compounds (small doses of atropine and cimetidine: 3) changes in the gastric mucosal vascular permeability due to chemicals; 4) effect of indomethacin in the ETOH and HCl models with and without surgical vagotomy; 5) changes in the gastric mucosal content of prostacyclin and PGE₂ in the ETOH and HCl models after surgical vagotomy; and 6) changes in the role of SH-groups in gastric mucosal defense after surgical vagotomy. It was found that: 1) the gastric mucosal damage produced by chemicals (ETOH, HCl, and indomethacin) was enhanced after surgical vagotomy; 2) the cyto- and general gastric protective effects of β-carotene, prostacyclin, and small doses of atropine and cimetidine disappeared after surgical vagotomy; 3) the vascular permeability due to chemicals (ETOH, HCl, indomethacin) significantly increased after surgical vagotomy in association with an increase in both number and severity of gastric mucosal lesions; 4) IND alone (in animals with an intact vagus) did not produce gastric mucosal lesions (in 1-h experiments), but it aggravated ETOH-induced gastric mucosal damage (both its number and severity); 5) the gastric mucosal levels of prostacyclin and PGE₂ decreased after surgical vagotomy; 6) IND application (after surgical vagotomy) decreased further the tissue levels of prostacyclin and PGE₂ in association with an increase of gastric mucosal damage; and 7) the gastric mucosal protective effects of SH-groups were abolished by surgical vagotomy.     

Exemestane experience in breast cancer treatment

Exemestane is a very potent, orally active, selective and long-lasting steroidal irreversible inhibitor of aromatase. It is 150 times more potent than aminoglutethimide (AG) in inhibiting human placental aromatase (K_i of 4.3 and 671 nM, respectively). The compound is presently under phase III evaluation in Europe and the U.S.A. for the treatment of postmenopausal advanced breast cancer (ABC). Clinical pharmacology studies have been carried out with single doses ranging from 0.5 to 800 mg and repeated doses of up to 600 mg a day, in 132 postmenopausal healthy volunteers and in 185 post-menopausal women with ABC. Results obtained using a very specific and sensitive analytical method (high performance liquid chromatography—radioimmunoassay; HPLC—RIA) indicated that exemestane is extremely effective in inhibiting plasma estrogens levels. Estrogen inhibition is clearly evident at 5 mg a day and maximal suppression for E₂, E₁ and E₁S (>85%, >90% and>90%, respectively) is obtained at 10–25 mg a day. Data from non-controlled phase II studies involving more than 400 patients indicated a clear anti-tumour activity in postmenopausal ABC patients failing multiple hormonal treatments. In 62 patients progressing on AG (≥500 mg a day) exemestane treatment resulted in an objective response rate of approximately 24%; disease stabilization ≥24 weeks was observed in an additional 24% of cases. With regard to safety, although daily doses up to 600 mg were administered, the maximal tolerated dose was not achieved; reported symptoms were mainly related to the pharmacological action of the compound and were usually mild to moderate in severity, resulting in the discontinuation of therapy in less than 3% of cases. In conclusion, the available results suggest that exemestane treatment is associated with minimal toxicity, and may be of significant benefit for ABC women who have exhausted conventional therapy.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.     

An immunochemical study of antigen expression in potato spindle tuber viroid (PSTV) - infected tomato leaves and calluses

A polyspecific antiserum against protein extracted from PSTV-infected tomato leaves was prepared and the IgGs were separated by affinity chromatography on a beaded cellulose adsorbent with an immobilized “healthy” antigen. The antibody not adsorbed entered into a preferential reaction with the antigen from PSTV-infected leaves as estimated by an enzyme-linked immunosorbent assay. The immunochemical reactions did not significantly exceed the control background, if antigens from tomato leaves infected with potato viruses X, Y and M were analyzed. By immunoblot technique we revealed, however, that several antigens not detected in healthy leaves appeared in the leaves infected either with PSTV or with viruses X and M. An accumulation of a major antigen having a molecular mass of about 70 kDa was observed in viroid-infected leaves only, suggesting the specificity for viroid infection. The antigen was found not to be an alkaline endoproteinase - the pathogenesis-related protein P-69. Some antigens with molecular masses approximately 38.0, 23.7 and 22 kDa, which occurred in PSTV-infected leaves and in healthy calluses, were not detectable in PSTV-infected calluses. No reaction exceeding the control level was observed using enzyme-linked immunosorbent assay for antigens from silver nitrate-treated tomato leaves, although such leaves showed symptoms similar to that caused by viroids.