Human papillomavirus type 16 DNA cooperates with activated ras in transforming primary cells.

The close association of human papillomavirus type 16 DNA with a majority of cervical carcinomas implies some role for the virus in this type of cancer. To define the transforming properties of HPV-16 DNA in vitro we have now performed transfection experiments on baby rat kidney cells using HPV-16 DNA in conjunction with an activated ras gene. We have demonstrated that a 6.6-kb DNA fragment, containing the early genes of HPV-16 under the control of Moloney murine leukaemia virus long terminal repeats (MoMuLV-LTRs), cooperates with EJ-ras in transforming these cells. Both DNAs are required and neither alone is effective. The cooperating activity appears to reside in a protein or proteins derived from the E6/E7 region of the HPV-16 genome.     

Perforin is present only in normal activated Lyt2+ T lymphocytes and not in L3T4+ cells, but the serine protease granzyme A is made by both subsets.

We show that among the subsets of peripheral T lymphocytes (Lyt2+ L3T4- and L3T4+ Lyt2- cells) activated in short-term cultures by stimulation with H-2 incompatible leukocytes 97% of the cytolytic activity and all detectable perforin activity resides in the Lyt2+ cells. But both populations contain approximately equal amounts of a serine protease, granzyme A, the expression of which was previously thought to be restricted to cytolytic T lymphocytes.     

Models of fibronectin.

The radius of gyration of human plasma fibronectin was determined by light scattering both under conditions in which the molecule is in an extended conformation (ionic strength 1.01 M, pH 8) and close to its native, more compact conformation (ionic strength 0.16 M, pH 8). These values were found to be 17.5 +/- 0.8 nm and 10.7 +/- 0.9 nm respectively, for a constant mol. wt of 533,000 +/- 8000, in excellent agreement with the value of 520,000 deduced from its known composition. A set of models, each made of two identical, end-to-end joined chains of 28 beads, was then constructed, and their calculated physico-chemical parameters were compared with those available for the whole fibronectin molecule and for some of its proteolytic fragments in both conformations. Two possible models for the circulating form are presented here: in both, the fibronectin molecule is in a compact, tangled conformation, with the amino-terminal end of one chain folded over to the carboxy end of itself or of the other chain either in a hairpin or in a circular fashion. With the exception of the carboxy-terminal fibrin(ogen)-binding domains, all the domains appear to be well exposed to the solvent, and thus free to interact with potential ligands.     

Biogenesis of the glycosome in Trypanosoma brucei: the synthesis, translocation and turnover of glycosomal polypeptides.

Glycosomes, the microbodies of Trypanosoma brucei, contain a number of enzymes involved in glucose and glycerol metabolism. The biogenesis of three of these enzymes has been studied. Aldolase, D-glyceraldehyde-3-phosphate dehydrogenase and NAD-linked glycerol-3-phosphate dehydrogenase are all synthesized in the cytosol on free rather than on membrane-bound polysomes. In vitro, as well as in vivo, these polypeptides are synthesized at their mature size, and no evidence was found for any processing upon entry into the glycosomes. Continuous and pulse-chase labelling experiments with procyclic trypomastigotes revealed that the enzymes have a half-life in the cytosol of approximately 3 min or less, and then turn over rapidly in the glycosomes, with half-lives as short as 30 min.     

Contact-dependent regulation of vinculin expression in cultured fibroblasts: a study with vinculin-specific cDNA probes.

Vinculin specific cDNA clones were isolated from chicken embryo fibroblast (CEF) cDNA library in lambda gt11. The clones, ranging in size from 2.8 to 5.0 kb, were initially selected by rabbit antibodies to vinculin. Their identity was further confirmed by their specific reactivities with a battery of different vinculin-specific monoclonal antibodies. Southern blot analysis of restriction enzyme digested chicken spleen DNA suggested that all the isolated cDNA clones correspond to the same gene(s). Northern blot hybridization revealed that the vinculin-specific cDNA clones react with a single 6.5 kb mRNA in total cellular RNA preparations of CEF, whole chicken embryos and chicken gizzard smooth muscle. Moreover, fractionation of CEF poly(A)+ RNA by sucrose gradient centrifugation followed by translation in cell free system indicated that the mRNA coding for vinculin has a size of about 6.0-7.0 kb. The identity of these clones was finally confirmed by selection hybridization assay. The isolated vinculin-specific cDNA probes were subsequently used in order to study the effect of substrate adhesiveness on the expression of vinculin. We show here that cells cultured on highly adhesive substrate, such as endothelial extracellular matrix (ECM), form large vinculin-rich focal contacts, while cells grown on poorly adhesive substrate poly(2-hydroxyethyl methacrylate) [poly(HEMA)] contain only small distorted vinculin spots. These morphological differences were accompanied by over 5-fold reduction in vinculin synthesis in cells growing on poly(HEMA), compared to those cultured on the ECM and over 7.5-fold decrease in the levels of vinculin-specific mRNA.(ABSTRACT TRUNCATED AT 250 WORDS)     

Evidence suggesting that PrP is not the infectious agent in Creutzfeldt-Jakob disease.

It has been suggested that the infectious agents of scrapie and Creutzfeldt-Jakob disease (CJD) are 'prions' constituted by a protease resistant glycopeptide, PrP. To analyze the role of PrP in CJD infectivity we re-evaluated the biochemical characteristics of infectivity. First, when the infectious agent is not aggregated, infectivity is exquisitely sensitive to proteinase K treatment, and therefore a proteinase-K-resistant molecule (e.g. PrP) is unlikely to contain information essential for agent replication. Second, removal of sugar residues from Gp34 (the major precursor of the proteolyzed PrP band) failed to reduce infectivity. Third, one-half of the PrP peptides could be separated from significant infectivity using nondenaturing conditions with practical quantitative recovery of infectivity. These studies suggest that PrP in itself is unlikely to be the replicating component of the infectious agent. We suggest that these as yet undefined agents may consist of core protein and nucleic acid that are incompletely assembled in, and protected by, cell membranes. This hypothesis would explain the absence of conventional viral particles in these diseases, account for observed membrane pathology including altered behavior of endogenous membrane proteins, and would be consistent with the replication and transforming properties of CJD that indicate there is an agent specific nucleic acid.     

Xfin: an embryonic gene encoding a multifingered protein in Xenopus.

The Xenopus laevis genome was screened for putative DNA-binding gene products by using the 'finger' region of the Drosophila gene Krüppel as a probe. The one gene detected, named Xfin, codes for a protein with 37 finger domains that comprise nearly 90% of the protein. In the light of studies by Rhodes and Klug (Cell, 46, 123-132, 1986), these data suggest that the Xfin protein has the capacity to bind an unusually large stretch (185 bases) of DNA. The Xfin gene is expressed as a maternal and zygotic mRNA that undergoes extensive polyadenylation changes during early development. The Xfin mRNA expression pattern and the potential DNA binding activity of the protein point to the possibility that the Xfin gene may have a role in controlling gene activity during early embryonic development.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.