Detection of virulence associated genes in clinical strains of vibrio mimicus

A total of 42 clinical strains of Vibrio mimicus were examined for the presence of virulence associated genes toxR, toxS, toxT, tcpP, ctx and tcpA by PCR assay. Almost all strains were shown to have the toxR gene, while the toxS gene was found in 27 strains. On the other hand, five strains possessed both toxT and tcpP genes, but others had neither. Only two strains were positive for amplification of the ctx gene, whereas no PCR product with tcpA primers was detected. The results indicate the incomplete copies of virulence cascade in V mimicus strains. The pathogenesis and epidemic potential of this species is also discussed.     

Characterization of four VNTR loci on human Chromosome 6

We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.     

The Textile Plot: A New Linkage Disequilibrium Display of Multiple-Single Nucleotide Polymorphism Genotype Data

Linkage disequilibrium (LD) is a major concern in many genetic studies because of the markedly increased density of SNP (Single Nucleotide Polymorphism) genotype markers. This dramatic increase in the number of SNPs may cause problems in statistical analyses, such as by introducing multiple comparisons in hypothesis testing and colinearity in logistic regression models, because of the presence of complex LD structures. Inferences must be made about the underlying genetic variation through the LD structure before applying statistical models to the data. Therefore, we introduced the textile plot to provide a visualization of LD to improve the analysis of the genetic variation present in multiple-SNP genotype data. The plot can accentuate LD by displaying specific geometrical shapes, and allowing for the underlying haplotype structure to be inferred without any haplotype-phasing algorithms. Application of this technique to simulated and real data sets illustrated the potential usefulness of the textile plot as an aid to the interpretation of LD in multiple-SNP genotype data. The initial results of LD mapping and haplotype analyses of disease genes are encouraging, indicating that the textile plot may be useful in disease association studies.     

Role of serum factors in the phagocytosis of weakly or heavily encapsulated Cryptococcus neoformans strains by guinea pig peripheral blood leukocytes

We investigated the opsonic activity of the serum factors affecting phagocytosis of Cryptococcus neoformans in vitro to elucidate the role of humoral factors in the host defense mechanisms against cryptococcosis. Two strains of C. neoformans, one heavily and one weakly encapsulated, were used. Guinea pig peripheral blood leukocytes (PBLs) were used for phagocytosis. The viable weakly encapsulated cells were ingested effectively by PBLs, in the presence of guinea pig normal fresh serum, while the heavily encapsulated cells were not ingested. Neither immune serum, its IgG fraction alone, nor heated serum promoted the phagocytosis of either the weakly or heavily encapsulated strain. On the other hand, immune serum promoted adherence of PBLs to viable cells of the heavily encapsulated strain, forming rosettes in the presence of fresh serum. A substantial amount of C3b component was detected on yeast cells when weakly encapsulated cells were incubated with human fresh serum, or heavily encapsulated cells were incubated with rabbit immune serum together with human fresh serum. Serum chelation experiments also indicated that the factors involved in the alternative complement pathway are opsonins for the weakly encapsulated strain. These results suggest that the alternative pathway plays an important normal opsonic role for weakly encapsulated strains and that specific antibody plays an immune opsonic role for heavily encapsulated strains of C. neoformans via the classical pathway of complement activation.     

Cytotoxicity and Calcium-Dependent Antigen of Yersinia

The relationship between invasiveness and calcium dependency was examined in various strains of Yersinia enterocolitica and Y. pseudotuberculosis by using established cell lines. Infection with calcium-dependent bacteria resulted in the formation of microvilli and the adherence of bacteria on the cell surface, and the adherent bacteria were ingested 1.5 hr after infection. Morphological changes in the cells became visible 2 to 3 hr after infection, and intracellular multiplication of the ingested bacteria was noted. When the cells were incubated with bacteria at 37 C for 1.5 hr and then at 25 C, however, the morphological changes in the infected cells were not observed. No isogenic strains that had lost calcium dependency for growth at 37 C were able to elicit the morphological changes in the cells, though they possessed the ability to adhere to and penetrate the cells. The antigen(s) supposedly related to cytotoxicity of the calcium-dependent Yersinia was sought by using antibodies prepared against calcium-dependent bacteria and then absorbed with calcium-independent bacteria and with calcium-independent bacterial cytosol. Double diffusion tests between the antisera and bacterial cytosol extracts revealed the presence of an antigen which was a cytoplasmic substance common to all calcium-dependent but not calcium-independent strains of Y. enterocolitica and Y. pseudotuberculosis.