EBV increases phosphoinositide kinase activities in human B cells.

To determine whether EBV affects phosphoinositide kinase activities of human B cells, we compared the activities between EBV- and EBV+ human B cell lymphoma lines. The two types of human B cells contained both phosphatidylinositol (PtdIns) 4-kinase and phosphatidylinositol 4-phosphate (PtdIns(4)P) kinase activities irrespective of the presence of EBV. However, both activities were increased in EBV+ cells compared to EBV- cells. The increases were associated with neither altered Km values for substrates nor altered elution profiles in DEAE-cellulose chromatography. Furthermore, expression of a latent EBV protein, EBV nuclear Ag1 (EBNA1) in BHK cells by the transfection of EBNA1 DNA was accompanied by increased PtdIns 4-kinase and PtdIns(4)P kinase activities. These increases also were not associated with altered Km values for substrates. However, phospholipase C activity was altered in neither EBV+ cells nor in EBNA1-expressing cells. These results indicate that EBV selectively increases the two phosphoinositide kinase activities in human B cells, although the viral gene product has no intrinsic phosphoinositide kinase activity. PtdIns 4-kinase and PtdIns(4)P kinase cooperatively synthesize PtdIns 4,5-bisphosphate, the major source of 1,2-diacylglycerol and inositol 1,4,5-triphosphate, the two second messengers in transducing signals for cell activation. Such increase therefore may play a role in EBV-induced human B cell activation.     

Role of hydrosulfide ions (HS-) in methylmercury resistance in Saccharomyces cerevisiae.

Methylmercury-resistant mutants were obtained from Saccharomyces cerevisiae. They were divided into two complementation groups, met2 (homoserine O-acetyltransferase deficiency) and met15 (enzyme deficiency unknown), as reported previously. It was found that met15 was allelic to met17 (O-acetylserine and O-acetylhomoserine sulfhydrylase deficiency). Methylmercury toxicity was counteracted by exogenously added HS-, and both met2 and met17 (met15) mutants overproduced H2S. On the basis of these results, we conclude that met2 and met17 (met15) cause accumulation of hydrosulfide ions in the cell and that the increased level of hydrosulfide is responsible for detoxification of methylmercury.     

Possible role of sodium-hydrogen antiport in acetylcholine-induced relaxation of rat aorta.

The decreased extracellular Na concentration (25mM) attenuated vasodilator effect of acetylcholine (ACh) in norepinephrine-treated aortic ring. This attenuation was greater in the low Na medium substituted by Li, which can exchange intracellular H through Na-H antiport, as compared with that substituted by choline, which cannot. 10 microM amiloride canceled the difference between the two low Na mediums. Thus the inhibition of Na-H antiport may counteract the suppressive effect of decreased intracellular Na on ACh vasodilation, suggesting a possible role of Na-H antiport in a release of vasoactive substance(s) from endothelial cells.     

Structural and functional modifications of the manganese cluster in Ca(2+)-depleted S1 and S2 states: electron paramagnetic resonance and X-ray absorption spectroscopy studies.

The effect of extraction of weakly bound Ca2+ by low-pH treatment on the O2-evolving apparatus was studied by use of low-temperature electron paramagnetic resonance (EPR) and X-ray absorption spectroscopy. In low-pH-treated PSII membranes, an S2 EPR multiline signal with modified line shape was induced by illumination at 0 degrees C, but its signal amplitude decreased upon lowering the excitation temperature with concomitant oxidation of cytochrome (cyt) b-559 in place of Mn. The half-inhibition temperature for formation of the modified multiline signal was found at -33 degrees C, which was much higher than that for formation of the normal S2 state in untreated control membranes. Signal IIf was normally induced down to -30 degrees C, but its dependence on excitation temperature was different from that for modified S2. This was interpreted as indicating that the low-temperature blockage of modified S2 formation is due to the incapability of electron abstraction from the Mn cluster. The Mn K-edge of X-ray absorption near-edge structure (XANES) spectrum shifted to lower energy by 0.8 eV after low-pH treatment, but the shift was reversed by addition of Ca2+. Upon illumination at 0 degrees C of treated membranes, the K-edge energy was up-shifted by 0.8 eV, but was not upon illumination at 210 K. These results were interpreted as indicating that extraction of weakly bound Ca2+ by low-pH treatment gives rise to structural and functional modulations of the Mn cluster.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

A homozygous deletion in the c-erbA beta thyroid hormone receptor gene in a patient with generalized thyroid hormone resistance: isolation and characterization of the mutant receptor.

Different point mutations have been identified in the T3-binding domain of the c-erbA beta thyroid hormone receptor gene that are associated with variant phenotypes of generalized thyroid hormone resistance (GTHR). In most cases of GTHR, heterozygotes are affected; a single mutant allele results in the inhibition of the function of normal thyroid hormone receptors. We report here a novel genetic abnormality, a 3-basepair (bp) deletion in the T3-binding domain of the beta-receptor in a kindred, S, with GTHR. One patient, S1, was the product of a consanguineous union of two heterozygotes and was homozygous for this defect. Heterozygotes from kindred S harbored a CAC deletion at nucleotides 1295-1297, which resulted in the deduced loss of amino acid residue threonine at codon 332, and they displayed elevated free T4 levels and inappropriately normal TSH levels characteristic of other kindreds with GTHR. However, patient S1, who had two mutant alleles, had markedly elevated TSH and free T4 levels and displayed profound abnormalities in brain development and linear growth. A fibroblast c-erbA beta cDNA extending from codon 175 to stop codon 457 was cloned from patient S1, sequenced, and used to create a full-length mutant cDNA. The kindred S mutant receptor was synthesized in vitro and did not bind T3. This mutant receptor did bind with similar avidity as the wild-type human beta-receptor to thyroid hormone response elements of the human TSH beta (-12 to 43 bp) and rat GH (-188 to -160 bp) genes. Kindred S showed the effect in man of heterozygous and homozygous expression of a dominant negative form of c-erbA beta.     

Reconstitution of the 9 S estrogen receptor with heat shock protein 90

As a first step in the investigation of the reconstitution of steroid hormone receptor systems, we studied the reconstitution of 9 S estrogen receptor (ER) from purified vero ER, which is the estradiol binding subunit, and heat shock protein 90 (hsp 90). By using a phosphate buffer containing molybdate, thiocyanate, dimethylformamide, glycerol, etc., vero ER could be converted to 9 S ER with hsp 90, but not with the control protein, ovalbumin. Inactivation of ER during the reconstitution was suppressed partially by hsp 90, but not by ovalbumin. Like native 8 S ER, the reconstituted ER was sedimented at about 8.9 S and 4.6 S on glycerol gradient centrifugation in low and high salt buffers, respectively.     

Gametocytogenesis induction by ammonium compounds in cultured Plasmodium falciparum

Asexual parasites of a strain that seldom or never produce gametocytes in in vitro culture began gametocytogenesis after 24 h treatment with RPMI 1640 medium containing concanavalin A (final concentration, 10 micrograms ml-1) and ammonium carbonate (final concentration, 15 mM ml-1) or ammonium bicarbonate (final concentration, 15 mM ml-1). Gametocytogenesis was consistently observed from the 3rd day after the treatment. Concanavalin A enhanced gametocytogenesis induction by ammonium carbonate or ammonium bicarbonate, although concanavalin A does not itself have gametocytogenesis induction activity. Whereas no gametocytogenesis was observed after addition of concanavalin A and ammonium acetate (final concentration, 5-25 mM ml-1) or ammonium chloride (final concentration, 5-15 mM-1). Addition of ammonium compounds resulted in decrease of parasitemia, regardless of gametocytogenesis.     

Differential effects of brefeldin A on sialylation of N- and O-linked oligosaccharides in low density lipoprotein receptor and epidermal growth factor receptor

Low density lipoprotein receptor (LDL-R) is a membrane glycoprotein carrying both N- and O-linked oligosaccharides, processing of which is reflected in conversion from a precursor to mature form during its synthesis and intracellular transport. Treatment with brefeldin A (BFA) of mouse macrophage-like J774 cells, Chinese hamster ovary cells, and two human cancer cell lines (A431 and IMC-2) resulted in production of LDL-R with a molecular size 5-10 kDa smaller than that of the mature form in the control cells. Treatment with sialidase caused apparent reduction in the molecular size of LDL-R synthesized in all BFA-treated J774, Chinese hamster ovary, A431, and IMC-2 cell lines as observed for the mature form of the control cells. Thus, O-linked sugar chains of LDL-R were apparently sialylated in the BFA-treated cells. We also examined the effect of BFA on the processing of another membranous glycoprotein, epidermal growth factor receptor (EGF-R) carrying only N-linked oligosaccharides. EGF-R synthesized in the presence of BFA was found to have no response to sialidase treatment, suggesting that the drug blocks the sialylation of EGF-R. The results indicate that BFA causes different effects on the sialylation of LDL-R and EGF-R depending upon linkage types of their oligosaccharides.