Interleukin-4 enhances anti-IgM stimulation of B cells by improving cell viability and by increasing the sensitivity of B cells to the anti-IgM signal

The lymphokine IL-4 is a potent enhancer of anti-IgM-induced B cell proliferation. Although the mechanism of this enhancement is not known, a commonly held view suggests that IL-4 acts together with anti-IgM as a costimulating factor for the activation of a subpopulation of B cells. To evaluate this hypothesis we examined the effect of IL-4 on the proportion of B cells stimulated to divide by different doses of anti-IgM using flow cytometry in combination with measurements of tritiated-thymidine incorporation. The results suggest a novel and surprisingly simple model for the mode of action of IL-4. Our analysis revealed that at high saturating anti-IgM concentrations, the proportion of live B cells which enter into S phase of the cell cycle is the same (approximately 65%) for cells cultured with or without IL-4. Cultures containing IL-4, however, exhibit a twofold increase in thymidine uptake over cultures without IL-4. This increase can be explained completely by the ability of IL-4 to enhance the viability of small dense B cells over the first 24 hr from approximately 50 to 90% of the starting cell number. Normalizing the maximum response levels obtained with and without IL-4 reveals that B cells incubated with IL-4 exhibit a 10-fold decrease in the concentration of anti-IgM required to stimulate the half-maximum proliferation level. Furthermore, evaluation of the number of cells in S phase by flow cytometry and analysis of the kinetics of cell proliferation revealed that the increased response effected by IL-4 at lower anti-IgM concentrations was due to a greater number of proliferating B cells rather than the same number of cells undergoing a faster division rate. We also found a highly nonlinear relationship between B cell number and proliferative response, implying a requirement for an additional, cell cooperation-mediated, activating signal for maximum B cell proliferation. IL-4 enhanced proliferation by the same proportion at all cell concentrations indicating that it does not replace or alter this requirement for cell cooperation. Taken together these results suggest that anti-IgM in combination with a second unidentified cell-cooperation-dependent signal leads to proliferation of up to 65% of small resting B cells. IL-4 does not provide an essential activation signal but serves to raise the sensitivity of B cells to the anti-IgM-generated signal.(ABSTRACT TRUNCATED AT 400 WORDS)     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Helix-forming tendencies of amino acids depend on the restrictions of side-chain rotamer conformations: crystal structure of the tripeptide GAI in two crystalline forms.

In our attempts to design crystalline alpha-helical peptides, we synthesized and crystallized GAI (C11H21N3O4) in two crystal forms, GAI1 and GAI2. Form 1 (GAI1) Gly-L-Ala-L-Ile (C11H21N3O4.3H2O) crystals are monoclinic, space group P2(1) with a = 8.171(2), b = 6.072(4), c = 16.443(4) A, beta = 101.24(2) degrees, V = 800 A3, Dc = 1.300 g cm-3 and Z = 2, R = 0.081 for 482 reflections. Form 2 (GAI2) Gly-L-Ala-L-Ile (C11H21N3O4.1/2H2O) is triclinic, space group P1 with a = 5.830(1), b = 8.832(2), c = 15.008(2) A, alpha = 102.88(1), beta = 101.16(2), gamma = 70.72(2) degrees, V = 705 A3, Z = 2, Dc = 1.264 g cm-3, R = 0.04 for 2582 reflections. GAI1 is isomorphous with GAV and forms a helix, whereas GAI2 does not. In GAI1, the tripeptide molecule is held in a near helical conformation by a water molecule that bridges the NH3+ and COO- groups, and acts as the fourth residue needed to complete the turn by forming two hydrogen bonds. Two other water molecules form intermolecular hydrogen bonds in stabilizing the helical structure so that the end result is a column of molecules that looks like an incipient alpha-helix. GAI2 imitates a cyclic peptide and traps a water molecule. The conformation angles chi 11 and chi 12 for the side chain are (-63.7 degrees, 171.1 degrees) for the helical GAI1, and (-65.1 degrees, 58.6 degrees) and (-65.0 degrees, 58.9 degrees) for the two independent nonhelical molecules in GAI2; in GAI1, both the C gamma atoms point away from the helix, whereas in GAI2 the C gamma atom with the g+ conformation points inward to the helix and causes sterical interaction with atoms in the adjacent peptide plane. From these results, it is clear that the helix-forming tendencies of amino acids correlate with the restrictions of side-chain rotamer conformations. Both the peptide units in GAI1 are trans and show significant deviation from planarity [omega 1 = -168(1) degrees; omega 2 = -171(1) degrees] whereas both the peptide units in both the molecules A and B in GAI2 do not show significant deviation from planarity [omega 1 = 179.3(3) degrees; omega 2 = -179.3(3) degrees for molecule A and omega 1 = 179.5(3) degrees; omega 2 = -179.4(3) degrees for molecule B], indicating that the peptide planes in these incipient alpha-helical peptides are considerably bent.     

Normal mode refinement: crystallographic refinement of protein dynamic structure. II. Application to human lysozyme.

The dynamic structure of a protein, human lysozyme, is determined by the normal mode refinement of X-ray crystal structure. This method uses the normal modes of both internal and external motions to distinguish the real internal dynamics from the external terms such as lattice disorder, and gives an anisotropic and concerted picture of atomic fluctuations. The refinement is carried out with diffraction data of 5.0 to 1.8 A resolution, which are collected on an imaging plate. The results of the refinement show: (1) Debye-Waller factor consists of two parts, highly anisotropic internal fluctuations and almost isotropic external terms. The former is smaller than the latter by a factor of 0.72 in the scale of B-factor. Therefore, the internal dynamics cannot be recognized directly from the apparent electron density distribution. (2) The internal fluctuations show basically similar features as those predicted by the normal mode analysis, with almost the same amplitude and a similar level of anisotropy. (3) Correlations of fluctuations are detected between two lobes forming the active site cleft, which move simultaneously in opposite directions. This corresponds to the hinge-bending motion of lysozyme.     

On the mechanism of bacteriorhodopsin solubilization by surfactants

Purple membrane bacteriorhodopsin can be easily solubilized by Triton X-100 and other detergents, but not by deoxycholate. In order to understand this behavior, we have examined the effects of a variety of surfactants. We show that detergents containing the cholane ring (cholate, taurocholate, 3[(3-cholamidopropyl)diethyl-ammonio]propanesulfonic acid...) are virtually unable to solubilize native bacteriorhodopsin. However, when the protein is reconstituted in dimyristoyl phosphatidylcholine and solubilization is assayed at a temperature such that bacteriorhodopsin is in the form of monomers, solubilization by cholane detergents does occur. We propose that steric factors prevent access of the rigid planar surfactant molecules to the hydrophobic protein regions. These are perhaps located in the monomer-monomer interface, whose solvation by surfactants is essential for solubilization to occur. We note that the capacity of some detergents to solubilize bacteriorhodopsin is always associated within the same range of surfactant concentrations with bleaching (partial or total) of the protein chromophore. The detergent-induced bleaching is at least partially reversible, suggesting that free retinal remains associated to some membrane components. While some surfactant molecules remain tightly bound to the membrane protein, cholane detergents can be completely removed from bacteriorhodopsin. Our results indicate that a structure-function relationship exists for detergents applied to the solubilization of bacteriorhodopsin.     

Projection of Monte Carlo and molecular dynamics trajectories onto the normal mode axes: human lysozyme

A method is presented to describe the internal motions of proteins obtained from molecular dynamics or Monte Carlo simulations as motions of normal mode variables. This method calculates normal mode variables by projecting trajectories of these simulations onto the axes of normal modes and expresses the trajectories as a linear combination of normal mode variables. This method is applied to the result of the molecular dynamics and the Monte Carlo simulations of human lysozyme. The motion of the lowest frequency mode extracted from the simulations represents the hinge bending motion very faithfully. Analysis of the obtained motions of the normal mode variables provides an explanation of the anharmonic aspects of protein dynamics as due first to the anharmonicity of the actual potential energy surface near a minimum and second to trans-minimum conformational changes.     

An antigen present in the Drosophila central nervous system only during embryonic and metamorphic stages

We report here about an antigen that is expressed in the central nervous system (CNS) of Drosophila only during the embryonic and metamorphic stages. In Drosophila, axonogenesis and synaptogenesis occur twice during the development: first in the embryonic and second in the metamorphic stages. We generated monoclonal antibodies (MAbs) in order to obtain molecular probes for analyzing axonogenesis or synaptogenesis in the CNS on the assumption that good candidates for molecules responsible for such phenomena must be present in the neuropil during those stages exclusively. As a result, we found MAb 66B2 whose intense immunoreactivity in the neuropil of the CNS was observed exclusively in the embryo and pupa, and not in the larva and adult. Immunoblot analyses showed that MAb 66B2 binds specifically to a protein with an apparent molecular weight of 350 K and neutral pl in the prepupal CNS. A significant amount of the antigen was isolated in forms that were soluble without detergent. Results of immunohistochemistry with MAb 66B2 in a primary culture of embryos showed that some live cells in the ganglion-like cluster were stained, and that neuronal cell bodies and neurites emanating from there were negative. These results strongly suggest that the 66B2 antigen observed in the CNS is an extracellular matrix component secreted from nonneuronal cells. These developmental changes in the 66B2 immuno-reactivity in the CNS presumably reflect dynamic changes of an extracellular matrix in the CNS that are accompanied by axonogenesis or synaptogenesis. © 1992 John Wiley & Sons, Inc.     

Protein-lipid interactions. A nuclear magnetic resonance study of sarcoplasmic reticulum Ca2,Mg2+-ATPase, lipophilin, and proteolipid apoprotein-lecithin systems and a comparison with the effects of cholesterol.

Deuterium Fourier transform nuclear magnetic resonance (NMR) spectra at 34 MHz (corresponding to a magnetic field strength of 5.2 T) have been obtained of a variety of protein-lipid systems containing specifically deuterated phospholipids. The following systems were investigated as a function of temperature: sarcoplasmic reticulum ATPase (ATP phosphohydrolase, EC 3.6.1.3) complexed with 1-myristoyl-2-(14,14,14-trideuteriomyristoyl)-sn-glycero-3-phosphocholine (DMPC-d3) or 1,2-bis(16,16,16-trideuteriopalmitoyl)-sn-glycero-3-phosphocholine (DPPC-k6); human brain lipophilin complexed with DPPC-d6 or 1,2-bis(6,6-dideuteriopalmitoyl)-sn-glycero-3-phosphocholine (DPPC-6,6-d4); beef brain myelin proteolipid apoprotein (PLA) reconstituted with DMPC labeled as CD2 (or CD3) at one or more of positions 3, 4, 6, 8, 10, 12, or 14 of the sn-2 chain. For purposes of comparison, spectra were also obtained for bilayers containing cholesterol (CHOL). The results show that proteins either disorder or have little effect on hydrocarbon chain order in membranes above the gel to liquid-crystal phase transition temperature (Tc) of the pure lipids. Cholesterol, however, causes a very large ordering of the hydrocarbon chains above Tc, but both cholesterol and protein prevent chain crystallization (by effectively disordering chain packing) immediately below Tc. No evidence for any ordered "boundary lipid" in association with protein was found above Tc, perhaps due to the rough nature of protein surfaces. Above Tc, exchange between free bilayer and protein associated lipid is fast on the time scale of the deuterium NMR experiment (greater than or similar to 10(3) s-1). We have also obtained proton-decoupled phosphorus-31 nuclear magnetic resonance spectra at 60.7 MHz (corresponding to a magnetic field strength of 3.5 T) of DMPC, DMPC-AT-Pase, and DMPC-CHOL complexes. The results indicate that ATPase and CHOL CAUSE SMALL DECREASES IN 31P chemical shielding anisotropies but that in addition ATPase causes a four- to fivefold increase in 31P spin-lattice and Carr-Purcell spin-spin relaxation rates, suggesting the possibility of polar group protein-lipid interaction leading to increased correlation times in the region of the lipid phosphate head group.     

Chromosome polymorphism in populations of the grasshopper Trimerotropis pallidipennis from southern Argentina

Three populations of the grasshopper Trimerotropis pallidipennis from southern Argentina have been studied cytologically. A very characteristic B-chromosome was found in all three. They also showed geographical variability in respect of the presence of pericentric inversions, and the inversion system was found to influence chiasma frequency. The Laguna Blanca population, which is on the hypothetical pathway the species is believed to have followed during its migration from northern to southern latitudes, has the same karyotype composition as the N. American form, with fixed inversions in the 3 largest autosomes and the X-chromosome. Its members have a high total chiasma frequency and a great number of interstitial chiasmata. The Sierra de la Ventana population, situated at the absolute eastern border of the species distribution is highly polymorphic with respect to the presence of inversions in the medium chromosomes. Its members have the lowest total chiasma frequency and a greatly reduced number of interstitial chiasmata. Situated geographically between the other two, the Choele-Choel population has the highest frequency of inversions and many of them are homozygous. Its members have a higher total chiasma frequency than that observed in specimens from Sierra de la Ventana, and a greatly reduced number of interstitial chiasmata, similar to that observed in individuals from the latter population.     

Fluctuations of an alpha-helix.

Fluctuations in backbone dihedral angles in the α-helical conformation of homopolypeptides are studied based on an assumption that the conformational energy function of a polypeptide consisting of n amino-acid residues can be approximated by a 2n-dimensional parabola around the minimum point in the range of fluctuations. A formula is derived that relates 〈Δθ_iΔθ_j〉, the mean value of the product of deviations of dihedral angles ?_i and ψ_i (collectively designated by θ_i) from their energy minimum values, with a matrix inverse to the second derivative matrix F ,_n of the conformational energy function at the minimum point. A method of calculating the inverse matrix F _n^?1 explicitly is given. The method is applied to calculating 〈Δθ_iΔθ_j〉 for the α-helices of poly(L -alanine) and polyglycine. The autocorrelations 〈(Δ?_i)²〉 and 〈(Δψ_i)²〉 at 300°K are found to be about 66 deg² and 49 deg², respectively, for poly(L -alanine), and 84 deg² and 116 deg², respectively, for polyglycine. The length of correlations of fluctuations along the chain is found for both polypeptides to be about eight residues long.