Replication and cytopathic effects of ovine lentivirus strains in alveolar macrophages correlate with in vivo pathogenicity.

Ruminant lentiviruses share genomic sequences and biologic properties with human immunodeficiency viruses. Four ovine lentivirus strains were assessed for cytopathic effects and virus replication. Lentivirus isolate H/24 produced high virus titers and lysis of synovial cells but replicated slowly and caused no fusion of alveolar macrophages. Lentivirus isolates 84/28 and 85/14 produced low virus titers, less syncytia, and limited or no cell lysis in synovial cells and macrophages. In contrast, ovine lentivirus isolate 85/34 produced early peak virus titers and caused rapid fusion and lysis of both macrophages and synovial cells. Ovine lentivirus isolates which were cytopathic for macrophages induced lymphoproliferative disease when inoculated into lambs.     

A mouse model for poliovirus neurovirulence identifies mutations that attenuate the virus for humans.

A mutation in the genome of poliovirus type 3 that is known to reduce neurovirulence in humans similarly reduces neurovirulence in mice when incorporated into a mouse-adapted-human poliovirus recombinant. Viral recombinants with a uracil at nucleotide position 472 in the 5'-noncoding regions of their genomes are unable to replicate in the mouse brain. Viral recombinants with a cytosine at this position are neurovirulent in mice. Neurovirulence of poliovirus in mice may therefore prove to be a useful indicator of the genetic stability of new attenuating mutations created by site-directed mutagenesis.     

Mapping of the amino-terminal half of polyomavirus middle-T antigen indicates that this region is the binding domain for pp60c-src.

The majority of the carboxy-terminal half of polyomavirus middle-T antigen has been variously mutated and, with the exception of the putative membrane-binding domain (amino acids 394 to 415), was found to be largely dispensible for the transforming activity of the protein. A comparison of the small-T antigen amino acid sequences (equivalent to the region of middle-T encoded by exon 1) of simian virus 40, BK virus, polyomavirus, and a recently described hamster papovavirus highlighted regions of potential interest in mapping functions to the amino-terminal half of polyomavirus middle-T antigen. The regions of interest include amino acids 168 to 191 (previously investigated by this group [S. H. Cheng, W. Markland, A. F. Markham, and A. E. Smith, EMBO J. 5:325-334, 1986]), two cysteine-rich clusters (amino acids 120 to 125 and 148 to 153), and amino acids 92 to 117 (within the limits of the previously described hr-t mutant, SD15). Point mutations, multiple point mutations, and deletions were made by site-specific and site-directed mutagenesis within the cysteine-rich clusters and residues 92 to 117. Studies of the transforming ability of the altered middle-T species demonstrated that this activity is highly sensitive to amino acid changes. All four regions (as defined above) within the amino-terminal half of middle-T have now been studied in detail. The phenotype of the mutants is predominantly transformation defective, and the corresponding variant middle-T species are characterized by being either totally or severely handicapped in the ability to associate actively with pp60c-src. Whether the mutations affect the regions of interaction between middle-T and pp60c-src or simply interfere with the overall conformation of this domain is not known. However, there would appear to be a conformational constraint on this portion of the molecule with regard to its interaction with pp60c-src and by extension to the ability of the middle-T species to transform.     

DNA-dependent RNA polymerase subunits encoded within the vaccinia virus genome.

Antiserum to a multisubunit DNA-dependent RNA polymerase from vaccinia virions was prepared to carry out genetic studies. This antiserum selectively inhibited the activity of the viral polymerase but had no effect on calf thymus RNA polymerase II. The specificity of the antiserum was further demonstrated by immunoprecipitation of RNA polymerase subunits from dissociated virus particles. The presence in vaccinia virus-infected cells of mRNA that encodes the polymerase subunits was determined by in vitro translation. Immunoprecipitable polypeptides with Mrs of about 135,000, 128,000, 36,000, 34,000, 31,000, 23,000, 21,000, 20,000, and 17,000 were made when early mRNA was added to reticulocyte extracts. The subunits were encoded within the vaccinia virus genome, as demonstrated by translation of early mRNA that hybridized to vaccinia virus DNA. The locations of the subunit genes were determined initially by hybridization of RNA to a series of overlapping 40-kilobase-pair DNA fragments that were cloned in a cosmid vector. Further mapping was achieved with cloned HindIII restriction fragments. Results of these studies indicated that RNA polymerase subunit genes are transcribed early in infection and are distributed within the highly conserved central portion of the poxvirus genome in HindIII fragments E, J, H, D, and A.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Successful infection of the common marmoset (Callithrix jacchus) with human varicella-zoster virus.

The common marmoset, Callithrix jacchus, can be infected with human varicella-zoster virus (VZV), both wild-type strain KMcC and attenuated vaccine strain Oka/Merck. Infection was accomplished with either whole-cell-associated or cell extract VZV by combined oral-nasal-conjunctival application and was characterized by substantial and persistent anti-VZV antibody responses. The infectivity of VZV for marmosets was destroyed by treatment of inocula with heat or UV light. Diluted inocula with as few as 40 PFU/ml were infectious for marmosets. The lungs were demonstrated to be a major site of viral replication; both the presence of viral antigens and signs of pneumonia were demonstrated in lung tissues. Four serial passages of VZV KMcC were carried out in C. jacchus by a process of in vitro isolation and culturing of VZV from infected lung tissue and reapplication of the cultured isolates to fresh animals. The isolated viruses were identified as VZV both serologically and by restriction endonuclease analyses. The C. jacchus infectivity model should prove useful for determining the efficacy of subunit and live recombinant VZV vaccines as well as for the study of zoster.