Genomic analysis identifies candidate pathogenic variants in 9 of 18 patients with unexplained West syndrome

West syndrome, which is narrowly defined as infantile spasms that occur in clusters and hypsarrhythmia on EEG, is the most common early-onset epileptic encephalopathy (EOEE). Patients with West syndrome may have clear etiologies, including perinatal events, infections, gross chromosomal abnormalities, or cases followed by other EOEEs. However, the genetic etiology of most cases of West syndrome remains unexplained. DNA from 18 patients with unexplained West syndrome was subjected to microarray-based comparative genomic hybridization (array CGH), followed by trio-based whole-exome sequencing in 14 unsolved families. We identified candidate pathogenic variants in 50 % of the patients (n = 9/18). The array CGH revealed candidate pathogenic copy number variations in four cases (22 %, 4/18), including an Xq28 duplication, a 16p11.2 deletion, a 16p13.1 deletion and a 19p13.2 deletion disrupting CACNA1A. Whole-exome sequencing identified candidate mutations in known epilepsy genes in five cases (36 %, 5/14). Three candidate de novo mutations were identified in three cases, with two mutations occurring in two new candidate genes (NR2F1 and CACNA2D1) (21 %, 3/14). Hemizygous candidate mutations in ALG13 and BRWD3 were identified in the other two cases (14 %, 2/14). Evaluating a panel of 67 known EOEE genes failed to identify significant mutations. Despite the heterogeneity of unexplained West syndrome, the combination of array CGH and whole-exome sequencing is an effective means of evaluating the genetic background in unexplained West syndrome. We provide additional evidence for NR2F1 as a causative gene and for CACNA2D1 and BRWD3 as candidate genes for West syndrome.     

Phosphoproteome analysis of Lotus japonicus seeds

In this study, we report the first dataset of phosphoproteins of the seeds of a model plant, Lotus japonicus. This dataset might be useful in studying the regulatory mechanisms of seed germination in legume plants. By proteomic analysis of seeds following water absorption, we identified a total of 721 phosphopeptides derived from 343 phosphoproteins in cotyledons, and 931 phosphopeptides from 473 phosphoproteins in hypocotyls. Kinase‐specific prediction analyses revealed that different kinases were activated in cotyledons and hypocotyls. In particular, many peptides containing ATM‐kinase target motifs, X‐X‐pS/pT‐Q‐X‐X, were detected in cotyledons. Moreover, by real‐time RT‐PCR analysis, we found that expression of a homolog of ATM kinase is upregulated specifically in cotyledons, suggesting that this ATM‐kinase homolog plays a significant role in cell proliferation in the cotyledons of L. japonicus seeds. The data have been deposited to the ProteomeXchange with identifier PXD000053 ( http://proteomecentral.proteomexchange.org/dataset/PXD000053 ).     

Effects of green tea polyphenol on the quality of canine semen after long-term storage at 5 °C

The aim of the present study was to determine the effects of green tea polyphenol on the quality of canine semen after long-term storage at 5 °C. The supplementation of a Tris-egg yolk extender with polyphenol (0.5, 0.75, or 1 mg/mL) increased the motility and viability of sperm preserved for four weeks at 5 °C.     

The effect of relaxin supplementation of in vitro maturation medium on the development of cat oocytes obtained from ovaries stored at 4 °C

Relaxin is a member of the insulin-like family of hormones that promotes growth in a number of reproductive tissues, including the granulosa and theca cells. Cat oocytes collected from cold-stored ovaries remain capable of maturing in vitro, but the developmental ability of the oocytes decreases after 24 h of cold storage. To improve the developmental ability of cat oocytes from cold-stored ovaries, we investigated the effect of relaxin supplementation of maturation medium on their meiotic ability and subsequent development. Cat oocytes were collected from ovaries stored at 4 °C for one day and cultured in maturation medium supplemented with different concentrations (0, 10, 20, and 40 ng/ml) of relaxin for 24 h. They were then fertilized in vitro for 12 h with frozen-thawed spermatozoa. After in vitro fertilization, the zygotes were cultured in synthetic oviduct fluid medium for 8 days. There were no significant differences in the maturation rates and glutathione contents of oocytes among the groups, irrespective of relaxin supplementation. The rate of blastocyst formation from oocytes matured with 10 ng/ml relaxin (16.0%) was higher (p < 0.05) than that from oocytes matured without relaxin (5.9%). Our findings indicate that supplementation of 10 ng/ml relaxin into maturation medium may improve blastocyst formation of cat oocytes after in vitro fertilization.     

Profilin is required for Ca2+ homeostasis and Ca2+-modulated bud formation in yeast

A cls5-1 mutant of Saccharomyces cerevisiae is specifically sensitive to high concentrations of Ca²⁺, with elevated intracellular calcium content and altered cell morphology in the presence of 100 mM Ca²⁺. To reveal the mechanisms of the Ca²⁺-sensitive phenotype, we investigated the gene responsible and its interacting network. We demonstrated that CLS5 is identical to PFY1, encoding profilin. Involvement of profilin in the maintenance of intracellular Ca²⁺ homeostasis was supported by the fact that both exchangeable and non-exchangeable intracellular Ca²⁺ pools in the cls5-1 mutant are higher than those of the wild-type strain. Several mutations of the genes whose proteins physically interact with profilin resulted in the Ca²⁺-sensitive phenotype. Examination of the intracellular Ca²⁺ pools indicated that Bni1p, Bem1p, Rho1p, and Cla4p are also required for the maintenance of Ca²⁺ homeostasis. Quantitative morphological analysis revealed that the Ca²⁺-induced morphological changes in cls5-1 cells are similar to bem1 and cls4-1 cells. Common Ca²⁺-induced morphological changes were an increase in cell size and a decrease of the ratio of budded cells in the population. Since a mutation allele of cls4-1 is located in the CDC24 gene, we suggest that profilin, Bem1p, and Cdc24p are required for Ca²⁺-modulated bud formation. Thus, profilin is involved in Ca²⁺ regulation in two ways: the first is Ca²⁺ homeostasis by coordination with Bni1p, Bem1p, Rho1p, and Cla4p, and the second is the requirement of Ca²⁺ for bud formation by coordination with Bem1p and Cdc24p.     

Recruitment of cyclin G2 to promyelocytic leukemia nuclear bodies promotes dephosphorylation of γH2AX following treatment with ionizing radiation

Cyclin G2 (CycG2) and Cyclin G1 (CycG1), two members of the Cyclin G subfamily, share high amino acid homology in their Cyclin G boxes. Functionally, they play a common role as association partners of the B′γ subunit of protein phosphatase 2A (PP2A) and regulate PP2A function, and their expression is increased following DNA damage. However, whether or not CycG1 and CycG2 have distinct roles during the cellular DNA damage response has remained unclear. Here, we report that CycG2, but not CycG1, co-localized with promyelocytic leukemia (PML) and γH2AX, forming foci following ionizing radiation (IR), suggesting that CycG2 is recruited to sites of DNA repair and that CycG1 and CycG2 have distinct functions. PML failed to localize to nuclear foci when CycG2 was depleted, and vice versa. This suggests that PML and CycG2 mutually influence each other’s functions following IR. Furthermore, we generated CycG2-knockout (Ccng2^−/−) mice to investigate the functions of CycG2. These mice were born healthy and developed normally. However, CycG2-deficient mouse embryonic fibroblasts displayed an abnormal response to IR. Dephosphorylation of γH2AX and checkpoint kinase 2 following IR was delayed in Ccng2^−/− cells, suggesting that DNA damage repair may be perturbed in the absence of CycG2. Although knockdown of B′γ in wild-type cells also delayed dephosphorylation of γH2AX, knockdown of B′γ in Ccng2^−/− cells prolonged this delay, suggesting that CycG2 cooperates with B′γ to dephosphorylate γH2AX. Taken together, we conclude that CycG2 is localized at DNA repair foci following DNA damage, and that CycG2 regulates the dephosphorylation of several factors necessary for DNA repair.     

Nishiyama Reservoir: Lead Sources,Inventory, and the Influence of the Nagasaki Atomic Bomb

Sediment core samples were obtained from Nishiyama Reservoir, 3 km east of the hypocenter of the Nagasaki atomic bomb, to evaluate both sources and inventories of lead delivery to the sediments. Using microwave digestions and ICP-MS analytical techniques, elevated concentrations of isotopically unique lead were identified in the 1945 sediment horizon. These results illustrate that the Nagasaki bomb attack can be linked with unique lead loading to the sediments in the region of the hypocenter. There is a possibility that the roll-up of in-situ lead accounted for a majority of the increase in lead flux delivered to reservoir sediments during the atomic bomb attack.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.